ID: 1192058029

View in Genome Browser
Species Human (GRCh38)
Location X:67793116-67793138
Sequence CTGGGGAGGGAGCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058024_1192058029 -10 Left 1192058024 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058016_1192058029 6 Left 1192058016 X:67793087-67793109 CCTCCCAAGCCTGGCTCCTCTTC No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058019_1192058029 -3 Left 1192058019 X:67793096-67793118 CCTGGCTCCTCTTCTGTGCCCTG No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058017_1192058029 3 Left 1192058017 X:67793090-67793112 CCCAAGCCTGGCTCCTCTTCTGT No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058018_1192058029 2 Left 1192058018 X:67793091-67793113 CCAAGCCTGGCTCCTCTTCTGTG No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058029 Original CRISPR CTGGGGAGGGAGCATGAGGA AGG Intergenic
No off target data available for this crispr