ID: 1192058030

View in Genome Browser
Species Human (GRCh38)
Location X:67793148-67793170
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058024_1192058030 22 Left 1192058024 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data
1192058027_1192058030 11 Left 1192058027 X:67793114-67793136 CCCTGGGGAGGGAGCATGAGGAA No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data
1192058028_1192058030 10 Left 1192058028 X:67793115-67793137 CCTGGGGAGGGAGCATGAGGAAG No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data
1192058019_1192058030 29 Left 1192058019 X:67793096-67793118 CCTGGCTCCTCTTCTGTGCCCTG No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058030 Original CRISPR AGTAATCAATACTGTTCTGC TGG Intergenic
No off target data available for this crispr