ID: 1192063660

View in Genome Browser
Species Human (GRCh38)
Location X:67857817-67857839
Sequence CCTTGCAAAGCTGACTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192063660_1192063662 -6 Left 1192063660 X:67857817-67857839 CCACAAAAGTCAGCTTTGCAAGG No data
Right 1192063662 X:67857834-67857856 GCAAGGCCACTTCTCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192063660 Original CRISPR CCTTGCAAAGCTGACTTTTG TGG (reversed) Intergenic
No off target data available for this crispr