ID: 1192069200

View in Genome Browser
Species Human (GRCh38)
Location X:67918766-67918788
Sequence CTGTTCCTGCAGGACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192069200_1192069212 13 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069212 X:67918802-67918824 GATGGTCTGTGGGTCCTCTTGGG 0: 4
1: 63
2: 175
3: 165
4: 235
1192069200_1192069204 -9 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069204 X:67918780-67918802 CAGGAACAGTCCACTTCCTCCGG No data
1192069200_1192069211 12 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069211 X:67918801-67918823 GGATGGTCTGTGGGTCCTCTTGG No data
1192069200_1192069207 2 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069207 X:67918791-67918813 CACTTCCTCCGGATGGTCTGTGG No data
1192069200_1192069208 3 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069208 X:67918792-67918814 ACTTCCTCCGGATGGTCTGTGGG No data
1192069200_1192069205 -5 Left 1192069200 X:67918766-67918788 CCTCCCAGGTCCTGCAGGAACAG No data
Right 1192069205 X:67918784-67918806 AACAGTCCACTTCCTCCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192069200 Original CRISPR CTGTTCCTGCAGGACCTGGG AGG (reversed) Intergenic
No off target data available for this crispr