ID: 1192073020

View in Genome Browser
Species Human (GRCh38)
Location X:67961229-67961251
Sequence CTCATTAGCACTCGTTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192073020_1192073021 9 Left 1192073020 X:67961229-67961251 CCAGAGTAACGAGTGCTAATGAG No data
Right 1192073021 X:67961261-67961283 GAGCTGTTGTTTTAAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192073020 Original CRISPR CTCATTAGCACTCGTTACTC TGG (reversed) Intergenic
No off target data available for this crispr