ID: 1192080103

View in Genome Browser
Species Human (GRCh38)
Location X:68039551-68039573
Sequence GGAGAGGTTGAACAACCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192080097_1192080103 22 Left 1192080097 X:68039506-68039528 CCTTTGATGTGCTGCTGAATTGT No data
Right 1192080103 X:68039551-68039573 GGAGAGGTTGAACAACCCTGGGG No data
1192080096_1192080103 28 Left 1192080096 X:68039500-68039522 CCACTTCCTTTGATGTGCTGCTG No data
Right 1192080103 X:68039551-68039573 GGAGAGGTTGAACAACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192080103 Original CRISPR GGAGAGGTTGAACAACCCTG GGG Intergenic
No off target data available for this crispr