ID: 1192080246

View in Genome Browser
Species Human (GRCh38)
Location X:68040809-68040831
Sequence ATGGAGAAACATACTGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192080246_1192080253 5 Left 1192080246 X:68040809-68040831 CCCCCCTCAGTATGTTTCTCCAT No data
Right 1192080253 X:68040837-68040859 ATTGATTAGGTTATAGTCAGTGG No data
1192080246_1192080251 -8 Left 1192080246 X:68040809-68040831 CCCCCCTCAGTATGTTTCTCCAT No data
Right 1192080251 X:68040824-68040846 TTCTCCATCTCTAATTGATTAGG No data
1192080246_1192080254 19 Left 1192080246 X:68040809-68040831 CCCCCCTCAGTATGTTTCTCCAT No data
Right 1192080254 X:68040851-68040873 AGTCAGTGGTCCTTAACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192080246 Original CRISPR ATGGAGAAACATACTGAGGG GGG (reversed) Intergenic
No off target data available for this crispr