ID: 1192080767

View in Genome Browser
Species Human (GRCh38)
Location X:68045839-68045861
Sequence GCAAGGGACCTTGTGGTTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192080767_1192080771 -2 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080771 X:68045860-68045882 GCTAGATAAGTGTGATATAATGG 0: 1
1: 0
2: 2
3: 10
4: 82
1192080767_1192080774 18 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080774 X:68045880-68045902 TGGGGAAAAAAAACTTGCATAGG 0: 1
1: 0
2: 2
3: 39
4: 343
1192080767_1192080775 25 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080775 X:68045887-68045909 AAAAAACTTGCATAGGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 290
1192080767_1192080776 26 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080776 X:68045888-68045910 AAAAACTTGCATAGGAGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 180
1192080767_1192080773 0 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080773 X:68045862-68045884 TAGATAAGTGTGATATAATGGGG 0: 1
1: 0
2: 0
3: 17
4: 235
1192080767_1192080772 -1 Left 1192080767 X:68045839-68045861 CCACAAACCACAAGGTCCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1192080772 X:68045861-68045883 CTAGATAAGTGTGATATAATGGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192080767 Original CRISPR GCAAGGGACCTTGTGGTTTG TGG (reversed) Exonic
900119739 1:1043443-1043465 GCAAAGGACCCTGTGGTCAGTGG + Exonic
900867890 1:5281581-5281603 GCAAGGGTCCTGGGGGTTAGGGG + Intergenic
902824509 1:18963754-18963776 TGAAGGGACCTTCTGGTGTGTGG - Intergenic
905856265 1:41316808-41316830 GCAAGGGCCATGGAGGTTTGGGG - Intergenic
905858336 1:41329848-41329870 GGAAGAGGCCTTGTGGTTTAGGG + Intergenic
907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG + Intronic
907826506 1:58022128-58022150 TCAAGGTACCTGGTGCTTTGAGG - Intronic
908185285 1:61646752-61646774 GCAAGAGAGTTTGTGGTGTGGGG - Intergenic
909521808 1:76577099-76577121 GGAAGGGAAATTGTGGTATGTGG + Intronic
912778522 1:112522755-112522777 GTCAGGGCCCTTGTGGTCTGCGG + Intronic
913696761 1:121333895-121333917 CCAAGGGAGCTTGGGGTTTTTGG + Intronic
914140799 1:144946165-144946187 CCAAGGGAGCTTGGGGTTTTTGG - Intronic
917580181 1:176369059-176369081 GCAATGGACCATGTGGTGTTGGG + Intergenic
920268116 1:204742170-204742192 GCAAGGGACCTTGTGACCTGAGG - Intergenic
920484092 1:206352249-206352271 CCAAGGGAGCTTGGGGTTTTTGG + Intronic
921703964 1:218298595-218298617 GAAAGGGAGCTGGAGGTTTGGGG + Intronic
923103071 1:230832708-230832730 GCCAGGGCCCATGTGGTTTCCGG + Intergenic
924495586 1:244585546-244585568 GGAAGGAACCTTGTGGTTGAAGG - Intronic
1065765178 10:29022769-29022791 GCAAGTGACCTGTTTGTTTGAGG + Intergenic
1065843779 10:29728155-29728177 GGAAGGGAGTTTGTGCTTTGTGG - Intronic
1066022615 10:31319032-31319054 GCTAGGGACCGGGCGGTTTGCGG - Intronic
1067189407 10:44057051-44057073 GCAAGTGCACTTGTGGTTGGAGG - Intergenic
1067794306 10:49309657-49309679 GCAAGGCACCCTGTGGCGTGGGG + Intronic
1071981410 10:91007816-91007838 GCACAGGGCCTAGTGGTTTGTGG - Intergenic
1076301735 10:129433516-129433538 GCCTGCGACCTTGTGGATTGGGG + Intergenic
1079679521 11:23277008-23277030 GGAAGGGACTTTGTGGTTTTGGG - Intergenic
1081420386 11:42869082-42869104 TGCAGTGACCTTGTGGTTTGAGG - Intergenic
1082917351 11:58451799-58451821 GCAAGGGATGTTGTGGATTCTGG - Intergenic
1083601586 11:63952007-63952029 GAAACGGGCCTTGTGGTTGGGGG + Intronic
1085449818 11:76625063-76625085 GGAGGGGACCTTGTGGTATCTGG + Intergenic
1085618542 11:78020525-78020547 CCAAGGGGCCTTGAGGTTTATGG - Intronic
1096573669 12:52539689-52539711 GCAAGGGCCCGTGTGGCTGGAGG + Intergenic
1102531856 12:113552712-113552734 GTAAGGGGCCTTGTGGTTACAGG + Intergenic
1102634457 12:114310842-114310864 TCAAGACACCTTGTGGTGTGTGG + Intergenic
1106117807 13:26832131-26832153 GCAAAGGAACTTGTGGTTAGAGG + Intergenic
1107655708 13:42590387-42590409 GTTAGGGACCTTGGGGTTGGGGG + Intronic
1113333787 13:109358106-109358128 ACCAGAGACCTTGTTGTTTGGGG + Intergenic
1113415907 13:110128279-110128301 GCAAAGGGGCTTGTGATTTGGGG - Intergenic
1114009790 14:18354672-18354694 TCAGGGGAACTTTTGGTTTGTGG + Intergenic
1119484775 14:74980277-74980299 GCCAGGGACCTAGTGGTCTTTGG + Intergenic
1121324915 14:93014234-93014256 GCATGGGGCCTTGTGGCTTAAGG - Intronic
1122599623 14:102914841-102914863 GCAAGGGACCTTGGACCTTGGGG + Intergenic
1126859603 15:52871130-52871152 GCAAGGCACCTAGTGTTGTGTGG - Intergenic
1128802335 15:70504774-70504796 GCCAGGAACCTTGAGGTTAGAGG - Intergenic
1131942139 15:97578588-97578610 TCTAGGGTCCTTATGGTTTGGGG + Intergenic
1137385485 16:48038719-48038741 GCATGGGACCCCATGGTTTGTGG + Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1145785612 17:27591906-27591928 GCAATGGACCGTGAGGTCTGAGG - Intronic
1148129717 17:45255514-45255536 GCCTGGGAGCTTGTGGTTGGAGG + Exonic
1152291493 17:79442481-79442503 GCAAGGCCCCTTGTGGTGAGAGG + Intronic
1152389367 17:79993564-79993586 GCAAAGGACCTTTTGTCTTGCGG - Intronic
1152458011 17:80427072-80427094 GCGAGGGCCATTGTGGTATGTGG - Intronic
1156541409 18:37915070-37915092 GCTAAGGTCCTTGTGGTTTAAGG + Intergenic
1156947895 18:42857201-42857223 GAACGTGACCTTGTAGTTTGTGG - Intronic
1157368467 18:47088284-47088306 GCTAGGGACCTTGGGACTTGAGG - Intronic
1161237643 19:3205737-3205759 GCAAGGGGCCTGGAGGTGTGGGG + Intronic
1161707650 19:5829570-5829592 GGAAGGGACACTGTGGTTAGAGG - Intergenic
1162922563 19:13912309-13912331 GCAAGGGACCTGGCGGTAGGGGG - Exonic
1163057552 19:14731989-14732011 GCAATGGACTCTGTGGTCTGGGG - Intronic
1164758566 19:30709426-30709448 GCAAGGGAGCGTGTGTTTGGGGG - Intronic
1165209842 19:34225518-34225540 GCATGAGTCATTGTGGTTTGGGG + Intronic
1165860858 19:38908614-38908636 GCAGGGGAACTTGGGCTTTGAGG + Intronic
927408490 2:22798891-22798913 GCAAGGGATGTTGTGGATTCTGG - Intergenic
930253838 2:49066269-49066291 GAAAAGGACTTTGTGATTTGTGG + Intronic
930553151 2:52861256-52861278 GCCACGGACTTTGTGGTTTTTGG - Intergenic
934721366 2:96579225-96579247 GGAAGAGAGCTTTTGGTTTGGGG - Intergenic
937206711 2:120241241-120241263 GCAGGGGACCTTGGGCCTTGTGG - Intronic
940789740 2:158019395-158019417 GCAGAAGACCTTGTGGGTTGGGG + Intronic
948248596 2:236507194-236507216 GCAAGCCACCTTCTGGCTTGGGG + Intronic
1172187284 20:33038924-33038946 GCCAGGGTCTTGGTGGTTTGTGG - Exonic
1177200546 21:17949896-17949918 CCAAGAGAACTTGTGGATTGAGG + Intronic
1178935396 21:36857600-36857622 GCGAGGGCCCTGGAGGTTTGGGG - Intronic
1179195715 21:39160733-39160755 GCAAGGAATCTTGTTCTTTGCGG + Intergenic
1180434290 22:15285481-15285503 TCAGGGGAACTTTTGGTTTGTGG + Intergenic
1180927670 22:19567341-19567363 GGCAGGGACCTTGTGGTGTAAGG + Intergenic
1181625235 22:24118591-24118613 GCAAGGGGTCCTGTGGTCTGTGG - Intronic
1182353652 22:29712515-29712537 GGAAGGGACCGTGCTGTTTGGGG + Intergenic
1184490106 22:44803525-44803547 GCAAGGGACGATGTGTTTGGGGG - Intronic
1185244031 22:49763811-49763833 GCAAGGGTCCTTGGGGTGTTGGG - Intergenic
950339582 3:12230795-12230817 GTAAGGGACCCTGTGGTGTTAGG + Intergenic
951522362 3:23621578-23621600 GCTAGGGACCCTCTGGTTTCTGG + Intergenic
952363841 3:32657539-32657561 GCATGTGAACTTGAGGTTTGTGG + Intergenic
953396150 3:42572079-42572101 GCTAGGGACCTTGGGGTCTGAGG + Intronic
953481161 3:43253687-43253709 TCATGGGACCTGGTGCTTTGGGG - Intergenic
954107123 3:48415442-48415464 GCAAGGGGTCGTGTGGTTTGGGG - Intronic
954711259 3:52506142-52506164 GCAAGGGACAGTGTGGCTTTAGG - Intronic
955408364 3:58640035-58640057 GCAAGGGACCTGGTGGCTCGAGG - Intronic
956782811 3:72617734-72617756 ACAACGTACCATGTGGTTTGTGG - Intergenic
960100827 3:113741279-113741301 GAAATGTACCTTGTGGTCTGTGG - Intronic
960894904 3:122493494-122493516 CCAAGGCTCTTTGTGGTTTGTGG - Intronic
964447638 3:156776837-156776859 GAAAGGGACCTTGTGTTCTGAGG + Intergenic
965953416 3:174338343-174338365 ACAAGGGACATTGTGGGATGTGG - Intergenic
968557012 4:1250564-1250586 GGAAGGGACGATGTGGTTGGTGG + Intergenic
974134300 4:57795265-57795287 TCCAGGCACCTTGTGGTTTGTGG + Intergenic
976222802 4:82771641-82771663 GCATGGGACCATGTGGTCTGTGG - Intronic
978789376 4:112644789-112644811 GCAAGTGGACTTCTGGTTTGGGG + Exonic
978877536 4:113659836-113659858 AAAAGGAACCTTCTGGTTTGAGG - Intronic
979571578 4:122232759-122232781 GCAAGCAACCTTGAGGGTTGAGG - Intronic
983279513 4:165662476-165662498 GCATGGGAGCCTGTGCTTTGTGG + Intergenic
984003350 4:174278703-174278725 GCAATGGCCTTTGTGGTTAGTGG - Intronic
998051472 5:139039597-139039619 GCTAGGGACCTTGGAGCTTGGGG - Intronic
998237000 5:140406515-140406537 GCAAAAGACCTTTTGGTTAGAGG + Intronic
999338179 5:150742771-150742793 GTAAGGGTCCTTTTGGTTTTTGG - Intronic
1003981395 6:11393619-11393641 GCAAGGCCCTATGTGGTTTGTGG - Intergenic
1004319502 6:14621486-14621508 GGAAGGGACCCTGGGCTTTGGGG - Intergenic
1004760850 6:18664434-18664456 GCTGGGGACCTTCTGGTCTGAGG - Intergenic
1006887353 6:37393732-37393754 GCAGGGGACTTTGTCCTTTGTGG + Exonic
1007250539 6:40492115-40492137 GAAAGGGACCCTGTGGTCTAAGG + Intronic
1007710146 6:43817643-43817665 GCAAGGATCCTTGTGGATTATGG + Intergenic
1010704082 6:79087082-79087104 GCAAGAGAGCTTGTTGTGTGGGG - Intergenic
1011328589 6:86178335-86178357 ACAATGGACCTTGGGGCTTGGGG - Intergenic
1014178365 6:118354840-118354862 GAAAGTGACAATGTGGTTTGAGG - Intergenic
1021403798 7:20240535-20240557 GAAAGGGTACTTGTGGTTGGTGG - Intergenic
1023493142 7:40765851-40765873 GGAAGGGGCCTTGTGGTCAGAGG - Intronic
1026828022 7:73596104-73596126 GAAAGGGGCCCTGTGGTTTTGGG + Intronic
1027516808 7:79152348-79152370 GCAAAGCACCTTGTGCTTTTTGG + Intronic
1032215424 7:129953316-129953338 GCAAGGAACCTGCTGGTGTGGGG - Intergenic
1034934318 7:155188774-155188796 GGAAGGGACTTTGAGTTTTGTGG + Intergenic
1037150512 8:15629523-15629545 GAAAGGGACCCTGTCATTTGCGG + Intronic
1039965711 8:42281974-42281996 GCCAGGCACCTTTTGGTCTGAGG + Intronic
1041243542 8:55870105-55870127 GGCAGGGACTTTGGGGTTTGTGG - Intergenic
1042442673 8:68846246-68846268 GCAAGGGACTTAGTGCTTTCTGG + Intergenic
1042465177 8:69121391-69121413 ACAATGGACTTTGGGGTTTGGGG - Intergenic
1043969799 8:86516172-86516194 GCCAGGCACCTTTTGGTCTGTGG - Intronic
1050794020 9:9514059-9514081 ACAAGGGACTTTTTGCTTTGGGG - Intronic
1051027508 9:12630815-12630837 TCAAGGGACCATGTGATTAGAGG - Intergenic
1051152185 9:14094248-14094270 GCAAGAGACTTTGTGAATTGAGG + Intronic
1051318310 9:15868370-15868392 TCCTGGGACATTGTGGTTTGGGG + Intronic
1055511942 9:77003864-77003886 GGAAGGGGCCTTGTGGGCTGGGG - Intergenic
1056338867 9:85603803-85603825 TGAAGAGACCTTGTGCTTTGAGG + Intronic
1057413120 9:94835973-94835995 GCAAGGGATCTTGAGGTCTGAGG + Intronic
1061494393 9:130963447-130963469 GCAAGGGAGCCTGAGGCTTGGGG + Intergenic
1186858057 X:13644565-13644587 GCAAGGGTCCTTTTTGTGTGTGG + Intergenic
1191890194 X:65931862-65931884 GCAAGATACCTCCTGGTTTGAGG - Intergenic
1192080767 X:68045839-68045861 GCAAGGGACCTTGTGGTTTGTGG - Exonic
1194904454 X:99557540-99557562 GCAAGGGAACTTGTTGGATGAGG + Intergenic
1198834808 X:140793923-140793945 GTAAGGGAAATTCTGGTTTGGGG - Intergenic