ID: 1192081122

View in Genome Browser
Species Human (GRCh38)
Location X:68048887-68048909
Sequence CCCCAAGCTGTCCCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192081122_1192081125 -8 Left 1192081122 X:68048887-68048909 CCATGTCTGGGGACAGCTTGGGG 0: 1
1: 0
2: 3
3: 21
4: 296
Right 1192081125 X:68048902-68048924 GCTTGGGGAGGAGAAAATCTTGG 0: 1
1: 0
2: 1
3: 27
4: 266
1192081122_1192081126 16 Left 1192081122 X:68048887-68048909 CCATGTCTGGGGACAGCTTGGGG 0: 1
1: 0
2: 3
3: 21
4: 296
Right 1192081126 X:68048926-68048948 AAATGAAACCCACTCTAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192081122 Original CRISPR CCCCAAGCTGTCCCCAGACA TGG (reversed) Intronic
900333130 1:2146484-2146506 CGCCAGGCTTTCCCCAGATAGGG - Intronic
900396243 1:2454312-2454334 CCCCAGGCAGCCCCGAGACAGGG + Intronic
900457421 1:2783973-2783995 CCCCCAGCTGTCCCCAGTCCTGG - Intronic
900635501 1:3662856-3662878 CCCCATGCTGTCCTCACACTGGG - Intronic
900980328 1:6042625-6042647 CCCCAAACAGTCCCAAGGCATGG - Intronic
901063283 1:6483692-6483714 CACTAAGCTGTCCTCAGCCAGGG + Intronic
902255821 1:15187985-15188007 CACCAAGCTGGCCTCAGAAAAGG + Intronic
902392652 1:16115430-16115452 CCCCAAGCTGTCCCCATGAGAGG + Intergenic
902634617 1:17726990-17727012 CCCCAAGCTGTACTAGGACAGGG - Intergenic
902801929 1:18835773-18835795 CTCCTGGCTGTCCCCAAACATGG - Intergenic
904989286 1:34578597-34578619 CCCAAGGTTTTCCCCAGACATGG + Intergenic
905202119 1:36322480-36322502 CCCCGAGCTGTCCGCAGAGCCGG - Exonic
905474680 1:38217729-38217751 CCCCCAGCTGTCCCCCAGCATGG - Intergenic
905811942 1:40919470-40919492 CCCCAAACTGCCTCCAGCCATGG + Intergenic
906447941 1:45919677-45919699 CCCCAAGATGTACCCAGTCCTGG + Intronic
907917791 1:58886682-58886704 CCCCAGGCTGGCCCCAGATTGGG + Intergenic
912728456 1:112079711-112079733 CCCAAGCCTGTCCCCAGCCATGG - Intergenic
913645524 1:120850665-120850687 TTCTAAGCTGTCCCCAAACATGG + Intergenic
914081203 1:144412872-144412894 TTCTAAGCTGTCCCCAAACATGG - Intergenic
914176113 1:145281412-145281434 TTCTAAGCTGTCCCCAAACATGG - Intergenic
915316501 1:155031766-155031788 CCTGCAGCTGTCCCCAGCCAGGG - Exonic
915604598 1:156942573-156942595 CCCAAAGCAGTCCCTGGACAAGG - Intronic
915662748 1:157417390-157417412 CCCCAAGCTGTCCTTACACTTGG + Intergenic
915822789 1:159043011-159043033 CCCCAAGCTGCCCCCGGCCCAGG + Intronic
915979306 1:160410173-160410195 CCTCAAGTTCTCCTCAGACAGGG - Intronic
918169563 1:181983580-181983602 CTCAAAGCTGACCCCAAACATGG + Intergenic
920223894 1:204424240-204424262 CCCCAACCTGTCCTTAGAGAGGG + Exonic
920819718 1:209369092-209369114 CGCCAATCTGTCCCAAGAAAAGG + Intergenic
923683892 1:236141432-236141454 TCCCCAGCTCTCCCAAGACAAGG + Intergenic
924775837 1:247114047-247114069 CCCCAACCTTGACCCAGACAGGG - Intergenic
1065188728 10:23192415-23192437 CGCCTAGCTGCCCCCAGCCAGGG + Exonic
1066528378 10:36307723-36307745 CCTCAGGCTGCCCCCAGACAAGG - Intergenic
1067175718 10:43944071-43944093 CCCTAGGCTGACCCTAGACAAGG - Intergenic
1067467628 10:46512916-46512938 GCCCAACCTCTGCCCAGACAAGG + Intergenic
1067619558 10:47871689-47871711 GCCCAACCTCTGCCCAGACAAGG - Intergenic
1067941666 10:50661725-50661747 CCCCAAGAGGTGCCCAGACATGG - Intergenic
1068237583 10:54259295-54259317 ACCTAAGGTGACCCCAGACAGGG - Intronic
1070544962 10:77445046-77445068 CCCAAGGCTCACCCCAGACAGGG + Intronic
1070807113 10:79277095-79277117 CCCCCAACTCTCCCCAGACTGGG - Intronic
1070824352 10:79382092-79382114 CCCCAGGTTGGCCCCAGACTGGG - Intergenic
1070862903 10:79686683-79686705 CCCCAAGAGGGGCCCAGACATGG - Intergenic
1071454376 10:85833192-85833214 CCACAAGCAGTCCCCAGCCAGGG + Intronic
1072945041 10:99802399-99802421 CCAGGAGTTGTCCCCAGACAAGG + Intronic
1073643377 10:105275380-105275402 CCCCAGGATGTCCCCAGCCCAGG - Intergenic
1073735119 10:106336542-106336564 CCCAAAGCTCACCCCAGCCACGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075074551 10:119342125-119342147 CCCCAAGCTGGGCTCAGCCAAGG - Intronic
1076225223 10:128769333-128769355 CCCCAAGCCGTCCCCTATCAGGG - Intergenic
1076836825 10:133025392-133025414 GCCAGTGCTGTCCCCAGACAGGG - Intergenic
1076871217 10:133196023-133196045 CCCCATGCTGTCCACCCACATGG - Intronic
1076978965 11:195327-195349 CCCCAAGAGGACCCCTGACAAGG + Intronic
1077019345 11:410645-410667 CCCCCGGCTGTATCCAGACATGG - Intronic
1077240734 11:1509118-1509140 CCAACAGCTGTCCCCACACAGGG + Intergenic
1077362131 11:2145441-2145463 GCCCAACCTGTCCCCAGCCTGGG - Intronic
1077422861 11:2461072-2461094 CCCCAGGCTGCCCCCAGCCACGG - Intronic
1077463019 11:2720402-2720424 CCTTCAGCTGTCCCCAGGCAGGG - Intronic
1079157405 11:17961043-17961065 TCCCCAGCTCTCCCCAGAAAGGG + Intronic
1079201828 11:18383353-18383375 CCCTAAGCTGTCCCCATGCGAGG + Intergenic
1081747034 11:45480683-45480705 CCCACAGCTGTCCCCAGGGAAGG + Intergenic
1081914726 11:46723508-46723530 CCCCCAGCTTACCACAGACAGGG - Exonic
1084920262 11:72464044-72464066 CCCCAAGATGTCCCATCACAGGG - Intergenic
1085444610 11:76592057-76592079 CCCAAACCTGGCCCAAGACAAGG - Intergenic
1085709518 11:78816385-78816407 CCCCAAACTATCCCAAGATAGGG - Intronic
1089369811 11:117947359-117947381 CCCCTAGCTCTGCCCATACATGG - Intergenic
1090162343 11:124509095-124509117 CCCCAATCTGTCTCTAGAGAGGG - Intergenic
1091232312 11:133996653-133996675 CACACAGCTGTCCCCAGAGAGGG + Intergenic
1092002488 12:5044018-5044040 ACCCCAGCTCTCCCCAGAGAGGG + Exonic
1092111921 12:5970257-5970279 CCCCCCGCTGACCCCTGACATGG + Intronic
1092287300 12:7136109-7136131 CCCCAAACTGTCCATGGACATGG + Intronic
1094800069 12:34022778-34022800 CCCCAACCTGTCCCCACCCCAGG + Intronic
1096466826 12:51851297-51851319 CTCCTGGCTGTCCCCAGTCAAGG + Intergenic
1096684644 12:53279883-53279905 CCCCCTGCAGTCCCCAGACTAGG - Intronic
1098871842 12:75825464-75825486 CCCAAAGCTGCACCTAGACAGGG - Intergenic
1100468782 12:94872961-94872983 CCCCAAGCTGTCCCTGGAGGTGG + Intergenic
1100677072 12:96879592-96879614 CCCCAGTCTGTGCCCAGCCAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101950275 12:109169284-109169306 CCCCAAGCTCTTCACAGACATGG + Intronic
1103138792 12:118530718-118530740 GCCTAAGCTGTCCCCAGAGATGG + Intergenic
1104770038 12:131355853-131355875 CCAAAAGCTGTCCTCAGAGAGGG - Intergenic
1104810239 12:131616172-131616194 CCCAACGCTGTCCTCAGAGAGGG + Intergenic
1104955823 12:132465397-132465419 CCCCGACCTGCACCCAGACATGG - Intergenic
1105451879 13:20507451-20507473 CCCCAAGTGGACTCCAGACAAGG - Intronic
1105891446 13:24685236-24685258 CCCCAAGCTTTGACCAGCCATGG - Intronic
1106104012 13:26718207-26718229 CTCAAAGCTGAGCCCAGACATGG + Intergenic
1111310118 13:86473186-86473208 CACCTAACAGTCCCCAGACAGGG + Intergenic
1112025380 13:95406643-95406665 CCCCAAGCTGCTCTCAGGCAGGG - Intergenic
1113806977 13:113115643-113115665 CCCCTTCCTGTCCCCAGACAAGG + Exonic
1113909288 13:113834562-113834584 CCTCAAGCTGTCCCAGGACATGG - Exonic
1116672167 14:47857189-47857211 TCCCAAGCAGTGCCCAGATAAGG + Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1122136042 14:99633514-99633536 CCCCTAGCTGGGCCCAGACCTGG - Intergenic
1122965080 14:105119697-105119719 CCACAGGCTCTGCCCAGACAGGG + Intergenic
1123061906 14:105598296-105598318 CCCCACGCCCTCCCCAGAGAAGG + Intergenic
1123086649 14:105720027-105720049 CCCCACGCCCTCCCCAGAGAAGG + Intergenic
1123183323 14:106489937-106489959 CCCTGAGCTCTCCTCAGACAGGG + Intergenic
1124374620 15:29122270-29122292 CCCCAGGCTGTCCCCAAGCTGGG + Exonic
1125341799 15:38682865-38682887 TCCCAGGCTGCCCACAGACATGG - Intergenic
1125750031 15:42021664-42021686 CTCCAAGCTGTCCTGAGACCAGG - Intronic
1125769312 15:42154391-42154413 CCCCAAGCCCTGCCCAGACTAGG - Exonic
1126339189 15:47620855-47620877 CTCCAATCTGTCCCCAGGCTGGG + Intronic
1129467564 15:75732394-75732416 CCCCAACCTGGCCCCAGCCCTGG - Intergenic
1129659369 15:77544404-77544426 GCCCAATCTGTGACCAGACAAGG - Intergenic
1129665501 15:77577361-77577383 CCCCAAGTTCTCCCTGGACATGG + Intergenic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1129850714 15:78791984-78792006 CTGCCAGCTGTCCCCAGTCATGG - Intronic
1130064540 15:80593277-80593299 CCCCAGGCTGGCCCCAAGCAAGG - Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130101942 15:80900862-80900884 CCCCAGGCTGGCTGCAGACACGG + Intronic
1130258369 15:82336385-82336407 CCCCAAGCAGGCCCCAGCTATGG + Intergenic
1131233391 15:90675723-90675745 CTCCAAGCTGTTCCTAGCCAAGG + Intergenic
1132029755 15:98430134-98430156 CCCCAAGCTCTTCCCAGTCCTGG + Intergenic
1132828262 16:1915615-1915637 CCCCCATTTGCCCCCAGACAGGG + Intronic
1132888179 16:2191604-2191626 CCCCCAGCTCTCTCCAGCCAGGG + Intronic
1132982392 16:2745180-2745202 GCCCAATCTGCCCCCAGAGAAGG - Intergenic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1135524826 16:23206244-23206266 AGCCAAGCTATTCCCAGACAAGG - Intronic
1135779914 16:25291353-25291375 CCCAAAGCAGTGCCCAGTCAAGG + Intergenic
1137251852 16:46747047-46747069 CCCCTAGCTGTCCCCAAACAGGG + Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1138149079 16:54638314-54638336 TTGCAAGCTGTCCTCAGACAAGG - Intergenic
1139585312 16:67899100-67899122 CCCCTAGCTTTCCCCAGAAATGG + Intronic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1140019617 16:71225537-71225559 CCCCAAACTGTCCAGAGATAGGG - Intronic
1141029860 16:80578253-80578275 CCCCTGGCTTTCCCCAGCCAAGG - Intergenic
1141367158 16:83454244-83454266 CCACAAGCTATGCCCAGAGATGG - Intronic
1141850347 16:86640782-86640804 CCCCAAGCTGGCCCAAGACAGGG - Intergenic
1142287902 16:89178934-89178956 CCCCACGCTCTCCCCAGCCCTGG + Intronic
1142466455 17:140145-140167 CCCCAAGAGGACCCCTGACAAGG + Intergenic
1143001263 17:3796676-3796698 CTCTGAGCTGTCCCCAGCCACGG + Intronic
1143776376 17:9201852-9201874 CTCCAAGAACTCCCCAGACACGG - Intronic
1144872096 17:18377927-18377949 CCCCAAGGACTCCCCAGCCAAGG + Exonic
1145799461 17:27673743-27673765 CCCCATGCTACTCCCAGACAAGG + Intergenic
1146626348 17:34438319-34438341 CGCCACGCTGTCCCCTCACAGGG + Intergenic
1148094784 17:45044772-45044794 CCCTAAACTGTCTCAAGACAAGG + Intronic
1148185507 17:45640588-45640610 CCCAAGGCTGACCCCAGCCAGGG - Intergenic
1148227228 17:45907309-45907331 CCCGAAGCTTTCCCCAGCCTTGG + Intronic
1148632453 17:49121760-49121782 CCTCAGACTGACCCCAGACAGGG + Intergenic
1149628230 17:58095707-58095729 CACCAAGCTTTCATCAGACATGG - Intergenic
1150867623 17:68870340-68870362 CCCCAAACTGTCCCAAGATGGGG - Intronic
1150976403 17:70091896-70091918 ACCCAAGCTGTCACAGGACATGG - Intronic
1151176785 17:72295456-72295478 CCCCAAGCTCACCCCAAAGAAGG + Intergenic
1151227230 17:72656341-72656363 CCGCAGGCTGTCCCCTGACAAGG + Intronic
1151351606 17:73535151-73535173 CCCCCTGCTGTCCTCACACATGG - Intronic
1151671752 17:75574790-75574812 GCCCACGCTGAGCCCAGACATGG - Intronic
1152361358 17:79834585-79834607 CCGCAAGCTGTCCCCGACCAAGG - Exonic
1153348384 18:4052492-4052514 CCCCATGCTGTGCCCAGCCTCGG - Intronic
1158992971 18:62889198-62889220 CCCCAAACTCTTCCCAGAGAAGG - Intronic
1160144959 18:76356248-76356270 TGCAAAGCTCTCCCCAGACACGG + Intergenic
1160544249 18:79642207-79642229 CCCCTCGCTGTCCCCACACCAGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160803150 19:979768-979790 CCCCCAGCTCTCCCCAGCCAGGG + Intergenic
1160803173 19:979821-979843 CCCCCACCTCTCCCCAGCCAGGG + Intergenic
1160926959 19:1551071-1551093 CCCTGAGCTGTGCCGAGACATGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161079848 19:2305333-2305355 CCCCCAGCTGTCCTTAGATATGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161352929 19:3803822-3803844 CCTCAGGCTGTCCCCTCACAAGG - Intergenic
1161455575 19:4368200-4368222 CCCCGAGCTGTCACAAGACGTGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162660196 19:12162953-12162975 CCCGAAGCTGTACCCAATCAGGG + Intergenic
1162728224 19:12702286-12702308 CCCCAAGCTTGGCCCAGCCAGGG + Intronic
1162782332 19:13012760-13012782 CCCCAAGCTGTCCTCGGATTTGG - Intronic
1164536239 19:29088202-29088224 CCCCAAGATGGCTTCAGACAAGG - Intergenic
1164798980 19:31060240-31060262 CCCAAAGCAGACCTCAGACAAGG - Intergenic
1165026671 19:32967618-32967640 TCCCAGGCTGGCCCCAGACCTGG - Intronic
1166258456 19:41621597-41621619 CCCTAGGCTGACCCCAGTCAGGG - Intronic
1166411088 19:42555751-42555773 CCCCAGGCTGACCCCAGGCCAGG - Intronic
1166688595 19:44810001-44810023 CCCCAGCCTGTCCCCAGGGAGGG - Intronic
1166764008 19:45241840-45241862 CACAGATCTGTCCCCAGACAGGG - Intronic
1166948626 19:46412256-46412278 CCCCAGGTTGTCCTCAAACATGG + Exonic
1167663088 19:50807863-50807885 CCCAAAGATGGCCCCAGAGAGGG + Intergenic
1168393529 19:56029760-56029782 ACCCAGCCTGTCCACAGACAGGG - Intronic
1168686464 19:58352247-58352269 CCCCCAGCAGCCCCCAGAGATGG + Intronic
925995595 2:9290150-9290172 CCCAAAGCTTTCCCTGGACAAGG - Intronic
927150057 2:20190330-20190352 CCCGAAGCGGTTCCCAGGCATGG - Intergenic
927297158 2:21467993-21468015 CCCCAAACTGTCCCAAGATAGGG + Intergenic
928317723 2:30258841-30258863 CCCCATGTTGTTCCCGGACAAGG + Exonic
928412909 2:31068060-31068082 CCCCAAGCCCTGCCCAGAAAGGG + Intronic
932574676 2:72956129-72956151 CACCAGCCTGTCCCCAAACATGG - Intronic
934777905 2:96950578-96950600 GACCCACCTGTCCCCAGACAGGG + Intronic
936492411 2:112983590-112983612 CACCAAGCTGTTCCCACCCAAGG - Intronic
941074257 2:160989293-160989315 GCCCCAGCTCTCCCCAGACTTGG + Intergenic
944148979 2:196537292-196537314 TCCCACCCTGTCCCCATACATGG - Intronic
944235952 2:197441608-197441630 CCACAAGCAATCCCCAGAGAGGG + Intergenic
948465157 2:238148664-238148686 CCCCCAGCAGTCCCCAGTCAGGG + Intronic
948563182 2:238867286-238867308 CCCCAAGATGTCTCCAGGCTAGG - Intronic
948808013 2:240461245-240461267 CCCCACGCTGACCCCTGGCAAGG - Intronic
1170144698 20:13160191-13160213 CCCCAAGCTGTCTCAACAAAAGG - Intronic
1171006035 20:21466757-21466779 ACCCATGATGTCCCAAGACAGGG + Intergenic
1171185343 20:23120646-23120668 CCCAAAGCTGACCTGAGACAAGG - Intergenic
1171390635 20:24799479-24799501 ACCCACGCTGACCCCAGGCAGGG + Intergenic
1173207838 20:41008376-41008398 ACCCAACCTGACCCCAGAGAAGG - Intergenic
1174401038 20:50276100-50276122 CCAGAAGCTGACCCAAGACAAGG - Intergenic
1179496126 21:41772378-41772400 CACCAAGCTGGACCCAGTCAGGG - Intergenic
1179916528 21:44481483-44481505 CCCCATGCTGTTCCCATGCACGG - Intergenic
1179916546 21:44481545-44481567 CCCCATGCTGTTCCCATGCACGG - Intergenic
1179916564 21:44481607-44481629 CCCCATGCTGTTCCCATGCACGG - Intergenic
1179916582 21:44481669-44481691 CCCCATGCTGTTCCCATGCACGG - Intergenic
1179916646 21:44481917-44481939 CCCCATGCTGTTCCCATGCACGG - Intergenic
1179916664 21:44481979-44482001 CCCCATGCTGTTCCCATGCACGG - Intergenic
1180843045 22:18968111-18968133 CCCCATGCTGCCCCCCGACCTGG + Intergenic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181037813 22:20178360-20178382 CCCCACACTGGCCCCTGACATGG + Intergenic
1181885404 22:26018327-26018349 CCCCATGCTGTCCCCATGCCTGG - Intronic
1182334025 22:29571105-29571127 CCCCACCCTGACCCCACACATGG + Intronic
1182696768 22:32203664-32203686 CCCCAACCAGCCCCCAGCCATGG + Intergenic
1182696910 22:32204200-32204222 CCCCAACCAGCCCCCAGCCAAGG + Intergenic
1182864031 22:33586418-33586440 CGCCATGCTGCCCCCAAACAGGG + Intronic
1183380384 22:37487759-37487781 CCCCCAGCTGTCCTCATGCAGGG - Intergenic
1183545313 22:38452324-38452346 CCCCAGGCTCCACCCAGACAGGG + Intronic
1184645697 22:45893435-45893457 GTCCCAGCTGTCCCCAGCCAGGG - Intergenic
1185196430 22:49473389-49473411 CCTCAGTCGGTCCCCAGACAGGG + Intronic
950524409 3:13515770-13515792 CCCCCAGCTGTCCCCAGTGTAGG + Intergenic
953073685 3:39548236-39548258 CCCCAAGCTCTCACAAGCCATGG - Intergenic
953415288 3:42712185-42712207 CCCCAACCCCTCCCCAGCCAAGG - Intronic
953836883 3:46354246-46354268 CCCCAGGGTGTACCCAGACCCGG - Intronic
953906227 3:46869478-46869500 CCCCAAGGTTTCCCCAGAATAGG + Intronic
954872942 3:53781417-53781439 CACCAGGCTCTCCCCAGTCAGGG - Intronic
956656764 3:71559838-71559860 CCCCCAGCAGCCCCCAGACAAGG - Intronic
961012509 3:123446005-123446027 CCCCAAGCTGTACCCCTGCAAGG - Intronic
961453780 3:127014471-127014493 CCCTCAGCTGTCCCCCGAGACGG + Exonic
962343250 3:134602375-134602397 CCCTGAGCTGTCCCCATGCAAGG + Intronic
966191822 3:177278300-177278322 CTCCAAGTTCTCCCAAGACAAGG - Intergenic
966344907 3:178968507-178968529 CCCCAACCTCTCCACAGGCAGGG + Intergenic
968728864 4:2260609-2260631 CCCCAAACTGTCCCCAGTAGGGG + Intronic
968818723 4:2834791-2834813 TACCCAGCTGTCCCCAGACTGGG - Exonic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969518257 4:7660759-7660781 CACCAGGCTGTCCCCACACATGG - Intronic
969632582 4:8347074-8347096 CCTCATGCTGTCCCCACAAAGGG + Intergenic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971362577 4:25951397-25951419 CCTCCAGCTGCCTCCAGACATGG - Intergenic
984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG + Intergenic
985077166 4:186226957-186226979 CCCCATGCTCACCCCAGACCAGG - Intronic
985865132 5:2508714-2508736 CCCCCTGCTGCCCCCGGACATGG + Intergenic
990250918 5:53914220-53914242 CACCAAGCTTTCCTCAGAGAAGG - Intronic
990304657 5:54482386-54482408 GCCCAAGATGTCACCAGCCAAGG + Intergenic
991474421 5:67004300-67004322 CACCAAGCTGTCCAGGGACAAGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993646976 5:90474342-90474364 CCACAGGCTGTCCACACACAGGG + Exonic
997209101 5:132067296-132067318 CTCCCAGCTGTCCCCTGCCATGG + Intergenic
997633092 5:135384936-135384958 CCCCAAGTGGTCCCCAGAGCTGG + Intronic
997856326 5:137376156-137376178 GCCCTACCTGTCCCCAGACCTGG - Intronic
998967986 5:147561323-147561345 CCCCAAGCTGAGCCCACCCAGGG - Intergenic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
999178898 5:149654687-149654709 CCCCAACCTTTTCCCAGACTTGG - Intergenic
1001328816 5:170747965-170747987 CCCCAGGCTGTGCCCAGAAAGGG + Intergenic
1002093346 5:176817372-176817394 GCCCTAGGTGTCCCCAGCCAGGG + Intronic
1003198608 6:3938199-3938221 CCCACTGCTGCCCCCAGACATGG - Intergenic
1003886667 6:10527772-10527794 CCCCAATCTGTTCCTGGACACGG + Intronic
1008232217 6:48996708-48996730 CCCCAAACTGTCCCCAGATAGGG + Intergenic
1009239527 6:61167130-61167152 TCCTAATCTGTCCCCAGCCATGG + Intergenic
1009645006 6:66389663-66389685 GCCTGAGCAGTCCCCAGACAAGG + Intergenic
1011444589 6:87424057-87424079 GCCCAAGATGTCACCAGAAATGG - Intronic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1015031561 6:128601869-128601891 CCACCAGCTGGCCCCAGACAGGG + Intergenic
1016246268 6:141984871-141984893 CCCCAAGATCTCCCTAAACAGGG + Intergenic
1016374635 6:143407691-143407713 CCCCAAGGAGACCCAAGACATGG + Intergenic
1016534298 6:145093201-145093223 CAGCAGGCTGTCCCCAGCCAAGG - Intergenic
1019131843 6:169882695-169882717 CCGCAAGGTGTCCACAGGCATGG - Intergenic
1019298104 7:289768-289790 CCCCAAGCTGCCTCCAGGGACGG + Intergenic
1019333480 7:471687-471709 CCTCAAGATGGCCCCGGACAAGG + Intergenic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1022518253 7:30989095-30989117 CCCCAGCCTGACCCCAGACCCGG + Intronic
1024125556 7:46291069-46291091 CCCAAAGCTGTCCCTGGAAACGG + Intergenic
1026010478 7:66631932-66631954 CCCCAAGCTTCCCAAAGACAGGG - Intronic
1026266148 7:68797640-68797662 GCCGGAGCTGTCCCCTGACAAGG - Intergenic
1027252552 7:76408345-76408367 CTCCCAGCTGTCCCCAGTCCAGG - Intronic
1028109416 7:86921062-86921084 CCCTAAACTGTCCTGAGACAGGG - Intronic
1028882908 7:95900081-95900103 CCCCAAGCTGTGGCCGGAAAAGG - Intronic
1030521294 7:110601419-110601441 CCCCAAGATGTTCCCAGGAAAGG + Intergenic
1032874795 7:136026670-136026692 TTCCAATCTGTCCCCAGACCAGG + Intergenic
1033644004 7:143287370-143287392 CCAGCAGCTGTCCCTAGACAGGG - Exonic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1034978567 7:155461594-155461616 CACCACCCTTTCCCCAGACATGG - Intronic
1035274109 7:157737263-157737285 GCCCAAGCTCGCCCCAGACTGGG + Intronic
1035323969 7:158052867-158052889 ACCCAGGCTGTCCCCAGCCTAGG + Intronic
1035376625 7:158410961-158410983 CACCCAGGTGACCCCAGACATGG + Intronic
1036722491 8:11189705-11189727 CCCTAAGCAGTACACAGACAGGG - Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037894149 8:22640759-22640781 GTCCAAGCAGTCCCCAGCCAGGG - Intronic
1041188973 8:55333731-55333753 TCTGAAGATGTCCCCAGACAAGG + Intronic
1042281111 8:67057076-67057098 CCACAAGCTGTCCCTAGCAAAGG - Intronic
1043401700 8:79891272-79891294 CACGAAGCCGTCCCCAGAGAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1049213175 8:141395951-141395973 GCCCCATCTGTCCCCAGCCAGGG - Intronic
1049227880 8:141466356-141466378 CCCCATCCTCTCCCCAGGCAGGG - Intergenic
1049605502 8:143527343-143527365 GCCCAAGCTGTCCCCAGTGTGGG + Intronic
1050596481 9:7209532-7209554 GGCCAAGCTGTCTCCAGAAACGG - Intergenic
1052769315 9:32672957-32672979 CCTCAAGCTGTCCCAAATCATGG - Intergenic
1052978523 9:34430011-34430033 TCCCAAGCTGTCCCTGGCCAGGG - Intronic
1053098726 9:35351583-35351605 CTCCAGGCTTTCCCCAGATAAGG + Intronic
1057217582 9:93237982-93238004 CCCAGAGCAGTTCCCAGACAAGG - Intronic
1057585849 9:96327939-96327961 CCACTAGATGTCCCCAGAGAGGG + Intronic
1059481985 9:114598634-114598656 CCCCAGGCTGTCCCAGGACAAGG - Intergenic
1060187225 9:121571045-121571067 CCCCAAGCTGTCTCCCCCCAGGG + Intronic
1060265358 9:122108827-122108849 GCCCAAGCTGTCCCCTCACCAGG - Intergenic
1060719355 9:125964911-125964933 CGCCATGCTGCCCCCAGACCCGG - Intronic
1061042203 9:128146686-128146708 CCCCAGGGTGTCCCTACACAAGG - Intergenic
1061598111 9:131645832-131645854 CTCTAAGCCATCCCCAGACACGG - Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1062433558 9:136536215-136536237 CCCCCAGCTGCCTGCAGACAGGG + Intronic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186890553 X:13955437-13955459 CACCAAGCTGTCCCCAGGGGAGG - Intergenic
1188769296 X:34132001-34132023 CCCCAAGCTGACCCCAAAAGCGG - Exonic
1190288827 X:48978380-48978402 CACCAAGCCGGACCCAGACAGGG - Exonic
1190886322 X:54533490-54533512 CACCAAGCTGTCCACTGGCAGGG - Intronic
1191648573 X:63510389-63510411 CGGCAAGTTGTCCCCAGAAATGG + Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1192362106 X:70446595-70446617 TCCCAAGCTGTGCCAAGTCAGGG - Intronic
1194448909 X:94017852-94017874 TCCCAAGGCCTCCCCAGACATGG + Intergenic
1194809994 X:98377415-98377437 CCCAATGCTGTCCCTATACAGGG - Intergenic
1195613464 X:106894700-106894722 CCTCAAGGTGTCCCCAGTGATGG + Intronic
1199093240 X:143714503-143714525 ACCCTAGCTGTCCCCAGAACTGG + Intronic
1200086581 X:153610167-153610189 CCCCAGGCAGTCCCCGGCCAAGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1202342830 Y:23887815-23887837 CCCAAACCTGGCCCCTGACATGG + Intergenic
1202527938 Y:25782270-25782292 CCCAAACCTGGCCCCTGACATGG - Intergenic