ID: 1192081674

View in Genome Browser
Species Human (GRCh38)
Location X:68053719-68053741
Sequence GGCCCCCAGATCCTCCCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192081674_1192081684 14 Left 1192081674 X:68053719-68053741 CCGGCAGGGAGGATCTGGGGGCC 0: 1
1: 0
2: 4
3: 43
4: 332
Right 1192081684 X:68053756-68053778 ATGATGGTTGGCTTTTCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 211
1192081674_1192081682 -2 Left 1192081674 X:68053719-68053741 CCGGCAGGGAGGATCTGGGGGCC 0: 1
1: 0
2: 4
3: 43
4: 332
Right 1192081682 X:68053740-68053762 CCTCACTGGGGGGCGGATGATGG 0: 1
1: 0
2: 0
3: 9
4: 111
1192081674_1192081685 17 Left 1192081674 X:68053719-68053741 CCGGCAGGGAGGATCTGGGGGCC 0: 1
1: 0
2: 4
3: 43
4: 332
Right 1192081685 X:68053759-68053781 ATGGTTGGCTTTTCTCCTGGAGG 0: 1
1: 0
2: 2
3: 19
4: 211
1192081674_1192081680 -9 Left 1192081674 X:68053719-68053741 CCGGCAGGGAGGATCTGGGGGCC 0: 1
1: 0
2: 4
3: 43
4: 332
Right 1192081680 X:68053733-68053755 CTGGGGGCCTCACTGGGGGGCGG 0: 1
1: 0
2: 4
3: 42
4: 366
1192081674_1192081683 2 Left 1192081674 X:68053719-68053741 CCGGCAGGGAGGATCTGGGGGCC 0: 1
1: 0
2: 4
3: 43
4: 332
Right 1192081683 X:68053744-68053766 ACTGGGGGGCGGATGATGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192081674 Original CRISPR GGCCCCCAGATCCTCCCTGC CGG (reversed) Exonic
900488603 1:2935329-2935351 AGCCCCCAGCTCCTCCCTGCTGG + Intergenic
900525496 1:3126444-3126466 GGACCCCAGGTGCTGCCTGCAGG - Intronic
900690474 1:3977627-3977649 GGGCCCCTCATCCTCCCTGCTGG - Intergenic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
901059582 1:6465870-6465892 GGCCCCCAGACCCTCCTGGGAGG + Intronic
901086414 1:6614418-6614440 CGCCCCCAGCCCCTCCCCGCCGG + Intronic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
901653507 1:10756228-10756250 GGCCTCCAGAGCCTCCTTACAGG + Intronic
901701563 1:11047173-11047195 GGCGCCCACAGCCTCCCTGCAGG - Intronic
901720189 1:11191152-11191174 GACCCCAAGAACCTCCTTGCAGG - Intronic
902121350 1:14168709-14168731 GGCCCTCTGGTTCTCCCTGCTGG - Intergenic
902174625 1:14639829-14639851 GGCCACCAGCTGCTGCCTGCAGG + Intronic
902368644 1:15992458-15992480 GGCCCCCAGGTCCTCAGGGCAGG + Intergenic
902511932 1:16971443-16971465 GGACCACAGCCCCTCCCTGCAGG + Exonic
902681556 1:18047508-18047530 CGCTCCCAGAGCCTTCCTGCTGG + Intergenic
903170317 1:21548288-21548310 AGAACCCAGAGCCTCCCTGCTGG - Intronic
903238817 1:21968769-21968791 GGTTCCCACATCTTCCCTGCTGG + Intergenic
903242739 1:21994433-21994455 GGTTCCCACATCTTCCCTGCTGG + Intronic
904374454 1:30071336-30071358 AACCCCCAGGCCCTCCCTGCTGG + Intergenic
904894748 1:33806211-33806233 AGCCTCCAGATCCTCCCAGAGGG - Intronic
905003778 1:34694354-34694376 TGCCCCCCAATCCTCCCTTCAGG + Intergenic
905715252 1:40143993-40144015 TGGCCCCAGATCAGCCCTGCAGG - Intergenic
906315934 1:44786432-44786454 GACCCCCAGAGGCTCCCGGCGGG + Intronic
906588453 1:47001476-47001498 GGCACCCAGATCCTCAGAGCTGG + Intergenic
907581730 1:55578267-55578289 ACCTCCCAGATCTTCCCTGCAGG - Intergenic
910193775 1:84620724-84620746 TGCGCCCAGAGCCTCCCCGCTGG - Intergenic
910708723 1:90156911-90156933 GCCCCCCACCTCCTCACTGCTGG + Intergenic
911155734 1:94635066-94635088 GGCCCCCTCATTCTTCCTGCTGG + Intergenic
911751226 1:101500119-101500141 GGCCCCCATATCCTAGCTTCAGG - Intergenic
912467333 1:109883085-109883107 GGCCCCAGGCCCCTCCCTGCTGG + Intergenic
912950534 1:114117548-114117570 AGGCCCCAGCTCCTGCCTGCAGG + Intronic
913197808 1:116472535-116472557 GGGCCACAGATCCTACATGCTGG - Intergenic
914341024 1:146760681-146760703 GTCCCCCAGATCCTCCAAGAAGG - Intergenic
915206452 1:154273662-154273684 ATCCCCCAGCTACTCCCTGCAGG - Intronic
915561716 1:156691856-156691878 CGCCCCCAGATCTGCCCTGACGG + Intergenic
916589414 1:166176029-166176051 GGCCACCAGCTCCTCCCTGCAGG + Intergenic
916713665 1:167432941-167432963 GGCCCCCACATTTTGCCTGCTGG - Intronic
917583126 1:176396782-176396804 TGACCCCCGAACCTCCCTGCCGG + Intergenic
917788981 1:178487397-178487419 GGAGCCCAGATCCTGCCGGCCGG - Intergenic
920211693 1:204333131-204333153 GGCCCCCAGCTCCACCAGGCGGG + Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
920560085 1:206932605-206932627 GGCCCCCAGATCTCCCTTCCAGG - Intronic
921901562 1:220456647-220456669 GCCACCCAGATCCTCCATTCAGG - Intergenic
921944970 1:220880012-220880034 CGCCCCCAGATCCCCCACGCCGG - Exonic
922413437 1:225397540-225397562 GGCCACCAGCTCCTCCAGGCTGG + Intronic
922713586 1:227852747-227852769 GGCCCCCCAAGCCTCCCTTCTGG - Intergenic
922798086 1:228351416-228351438 GAGCCCCAGGTCCTCCTTGCTGG - Exonic
924672980 1:246147910-246147932 GCCCCCCACTTCATCCCTGCAGG + Intronic
1063372004 10:5528145-5528167 CAGCCCCAGATCCTCCCTGAGGG + Intergenic
1064338750 10:14467916-14467938 GGACCCCAAATGCTCACTGCAGG + Intergenic
1065771358 10:29081661-29081683 GGCCCACATGTCCTGCCTGCAGG - Intergenic
1065818865 10:29506884-29506906 GGCTCCCATCTCCTCCCTGCCGG - Intronic
1065918391 10:30370712-30370734 GGCCCCCAGACCCTTTCTTCAGG + Intronic
1067178705 10:43969221-43969243 GGCTCCCATATCCTCTCTGTCGG + Intergenic
1067414345 10:46092207-46092229 GCCTCCCAGTTCCTCACTGCAGG - Intergenic
1070719245 10:78745001-78745023 GGCACCCAGGTCTCCCCTGCAGG - Intergenic
1071530954 10:86389984-86390006 AGCCCGCAGCTCCTCCCTGATGG - Intergenic
1072659898 10:97357282-97357304 GGCCCCCTTCTCATCCCTGCTGG - Intronic
1073612209 10:104955745-104955767 AGCCCCCAGGTCATCCCTGCAGG - Intronic
1074112748 10:110434009-110434031 CGCCCGCAGAGCCTCCCTGCAGG + Intergenic
1074826194 10:117217080-117217102 TGACCCCACAGCCTCCCTGCGGG + Intergenic
1075337307 10:121617715-121617737 GGTGCCCAGATCCTCCCTCAGGG + Intergenic
1075651386 10:124130009-124130031 GGGCCCCAGATCAGCCCTCCAGG - Intergenic
1075776349 10:124991409-124991431 GGCCCCCAGCTCCACCCAACAGG + Intronic
1076522062 10:131087674-131087696 GGCCCCCTCATCCTCCCTGTGGG + Intergenic
1076566807 10:131404482-131404504 GGCTCCCAGCTCTTCTCTGCTGG - Intergenic
1077241170 11:1511065-1511087 GGGTCCCAGATGCTCACTGCTGG + Intergenic
1077367465 11:2166966-2166988 GGCCTCCAGGTGCTCCCCGCAGG + Exonic
1078413580 11:11147536-11147558 TTCCCCCACTTCCTCCCTGCAGG + Intergenic
1081774561 11:45668523-45668545 GACCTCCAGCTCCTCCCTGCAGG - Intergenic
1083293005 11:61700154-61700176 GGCCCCCAGAGCCCTCCTGTTGG + Intronic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1084065367 11:66700943-66700965 GGCCCTGAGGTCCTCCCAGCCGG + Exonic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084597962 11:70128470-70128492 GGCTGGCAGAGCCTCCCTGCTGG - Intronic
1086913984 11:92506290-92506312 GGCCCCAAGATCCTCCTTTCTGG + Intronic
1087018683 11:93580027-93580049 GGCCCCAAGAACCTTCCAGCAGG - Intergenic
1087743437 11:101915235-101915257 CGCCCCCAGAACCTCCCTCATGG - Exonic
1088814776 11:113413409-113413431 GGGCCCCACATCTTCCCTGCTGG + Intronic
1088834767 11:113568340-113568362 GGGACCCGGATTCTCCCTGCAGG + Intergenic
1089494429 11:118901186-118901208 GGCCTCCAGAGAATCCCTGCTGG + Exonic
1089560229 11:119339995-119340017 GCCCCCCAGATCTGCCCTGCGGG - Intronic
1089622835 11:119731604-119731626 GGCAGCCACATCTTCCCTGCTGG - Intergenic
1090865584 11:130697950-130697972 TCCCCACAGAGCCTCCCTGCAGG - Intronic
1090906851 11:131084275-131084297 GGCCCCCACCACCTCCCTCCCGG + Intergenic
1091305750 11:134535173-134535195 GGCCCCCAGCTCAGCCATGCTGG - Intergenic
1094536248 12:31324784-31324806 GGCCCCCCGACCCTCCCCTCGGG + Intronic
1095854242 12:46842824-46842846 GGCCACGGCATCCTCCCTGCTGG + Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1096541207 12:52308291-52308313 GGCTCCCAGACCCGCCCAGCGGG - Intronic
1096548432 12:52356741-52356763 GGCCTGCAGGTCCTCCCTGCAGG - Intergenic
1096974985 12:55694761-55694783 TGCCCCCAGGTCCTCACCGCAGG + Exonic
1101277038 12:103214309-103214331 AGCCCCCAAATCATCCCTACAGG - Intergenic
1102098293 12:110257783-110257805 GGACTTCAAATCCTCCCTGCAGG + Intergenic
1102466055 12:113131423-113131445 GGCCCCCAGCTCTCCCCTGCAGG + Intronic
1103527074 12:121576275-121576297 GGCCTTCAGATCCTCCCAGGTGG - Intronic
1103921899 12:124403526-124403548 CACCCCAAGGTCCTCCCTGCAGG + Intronic
1104031815 12:125070210-125070232 TGCCCCCAGACCATCCCTGTAGG + Intronic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1104635928 12:130437812-130437834 CGTCCCCAGCTCCGCCCTGCAGG - Intronic
1104899272 12:132179607-132179629 TGTCCCCAGCTCCTCCCTGGGGG - Intergenic
1104913137 12:132249918-132249940 AGGCCCCAGGTCCTGCCTGCTGG + Intronic
1112579069 13:100663005-100663027 CGCCCCCAGGGCGTCCCTGCTGG - Exonic
1113802278 13:113092824-113092846 GCTCCCCAGAGCCTCTCTGCGGG - Intronic
1113920827 13:113908378-113908400 GGCCAGCAGATCCTCCCGGTGGG - Intergenic
1113936203 13:113996347-113996369 GGGCCCCAGATGCTCCCTCGAGG + Intronic
1113940111 13:114014610-114014632 GGCACCCAGCTCCTCCCTGAGGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1119147803 14:72332578-72332600 GGACCCAAGATCCTGCCTCCTGG - Intronic
1119634723 14:76264663-76264685 ATCCCCCGGGTCCTCCCTGCAGG + Intergenic
1122124807 14:99573225-99573247 GACCTCCAGGTGCTCCCTGCAGG + Intronic
1122632407 14:103113015-103113037 AGCCCCCAGGCCCTGCCTGCCGG + Intergenic
1123176207 14:106421645-106421667 CGCCCCCTCAGCCTCCCTGCAGG + Intergenic
1202947478 14_KI270726v1_random:41920-41942 GGTCCCCTCAGCCTCCCTGCAGG - Intergenic
1123401293 15:19989712-19989734 TGCCCCCTGGTTCTCCCTGCTGG + Intergenic
1123439073 15:20276943-20276965 CGTGCCCTGATCCTCCCTGCAGG - Intergenic
1124983449 15:34583938-34583960 GTCCCGTAGATCCTCCCGGCTGG - Intronic
1125417341 15:39467364-39467386 TGCTCCCAGAGCCCCCCTGCTGG + Intergenic
1125719014 15:41836257-41836279 GTTCCCCAGCCCCTCCCTGCAGG - Intronic
1125833783 15:42733803-42733825 TCCCCCCAGGTCCTTCCTGCCGG - Intronic
1126142286 15:45448419-45448441 GCCCCACAGAGCCTGCCTGCTGG + Intronic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1129458875 15:75690008-75690030 GGCCACCAATGCCTCCCTGCTGG - Exonic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1129740494 15:77987393-77987415 GGTCCCCAGATGGTCACTGCAGG + Intronic
1129838855 15:78731141-78731163 GGCCCCCAGCTCCTTTCTTCAGG - Intergenic
1129845255 15:78765169-78765191 GGTCCCCAGATGGTCACTGCAGG - Intronic
1130256586 15:82328690-82328712 GGTCCCCAGATGGTCACTGCAGG + Intergenic
1130598365 15:85261298-85261320 GGTCCCCAGATGGTCACTGCAGG - Intergenic
1131218520 15:90560703-90560725 AGCGCCCAGATGCTGCCTGCTGG + Intronic
1132065763 15:98729654-98729676 GGCCCCCAGATACTGTCTCCAGG - Intronic
1132176124 15:99716678-99716700 GGCTCCCGGGTCATCCCTGCTGG + Intronic
1132581146 16:685193-685215 GGCACCCAGATCCTGACTGCCGG - Intronic
1132594022 16:740192-740214 GCCTCCCAGCTCATCCCTGCCGG + Intronic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1133229693 16:4360700-4360722 GGCCCCCCTCTCCTCACTGCTGG + Intronic
1133229723 16:4360787-4360809 GGCCCCCCTCTCCTCACTGCTGG + Intronic
1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG + Exonic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1135198682 16:20418069-20418091 GCCCCCCAAATCCTGCCTTCTGG + Exonic
1135470892 16:22729475-22729497 GCCACCCAGATCCCCACTGCTGG - Intergenic
1135524145 16:23200945-23200967 GGCCCCCAGATGCTCTCAGGAGG + Intronic
1135598675 16:23763205-23763227 TGCCTCCAGATGCTCCCTGAAGG - Intergenic
1136092939 16:27933723-27933745 GAACCCCAGAACCTCCCTTCTGG + Intronic
1136846097 16:33577401-33577423 CGTGCCCTGATCCTCCCTGCAGG + Intergenic
1137411485 16:48232032-48232054 GGCCCCAATATGCTCCCTGCAGG - Exonic
1137625757 16:49907295-49907317 TGCTCCCAGATCACCCCTGCAGG + Intergenic
1138605678 16:58086677-58086699 GGCCCCCTCATCCTCCCTCCAGG - Intergenic
1138749449 16:59401435-59401457 GGCATCCACATGCTCCCTGCTGG - Intergenic
1139429865 16:66905348-66905370 TGCCTCCTGATCCTCCGTGCTGG + Intergenic
1139993261 16:70956725-70956747 GTCCCCCAGATCCTCCAAGAAGG + Intronic
1140410618 16:74738497-74738519 AGACCCCAGCTCCTCCCTCCAGG + Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1141164623 16:81652289-81652311 GGCCCTGACATCCCCCCTGCAGG + Exonic
1142416831 16:89947889-89947911 TGTCCTCAGCTCCTCCCTGCGGG + Intergenic
1203107805 16_KI270728v1_random:1426055-1426077 CGTGCCCTGATCCTCCCTGCAGG + Intergenic
1144101894 17:11948877-11948899 AGCACCCAGGTCCTCCCTCCTGG - Intronic
1145759759 17:27419446-27419468 GGCTCCCAGATTCTGCCTGGCGG - Intergenic
1147538030 17:41333582-41333604 GGCCCCCCTCTCCTCCCTGCTGG - Intergenic
1148048876 17:44759582-44759604 GGCAGCCAGATCCTCCCACCCGG + Intronic
1148145341 17:45361095-45361117 AGACCCCATCTCCTCCCTGCAGG - Intergenic
1148741812 17:49897369-49897391 GGGCCCCAGTTCCTGCCTGAGGG - Intergenic
1148792910 17:50183654-50183676 GGCCCCCAGGTCCTCCTCACGGG + Exonic
1148795423 17:50194611-50194633 GGCTACCAGGTCCACCCTGCAGG + Exonic
1151365540 17:73614058-73614080 GGCCCACTGGGCCTCCCTGCCGG + Intronic
1151517940 17:74608690-74608712 GGCCCACACAGCATCCCTGCAGG + Intergenic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1151625579 17:75273419-75273441 GGACCCCAGGTCTTCCCTGGAGG - Exonic
1152030711 17:77841065-77841087 GGCCCCACGGTCCTACCTGCTGG - Intergenic
1152350967 17:79784006-79784028 GGCCCCCAGATCCTTCCGGGCGG - Exonic
1152595092 17:81234017-81234039 GGCCCCCAGATCCTCTGCACGGG - Exonic
1153947804 18:10032515-10032537 GGCCCCCAGGGCCTCGCTGGCGG + Intergenic
1154502370 18:15003259-15003281 GCCTCCCAGATCCTGCCTGTGGG + Intergenic
1157312949 18:46566117-46566139 AGCCCCCATTTTCTCCCTGCAGG + Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1157903374 18:51542626-51542648 GGACCCCATCCCCTCCCTGCAGG + Intergenic
1159124471 18:64207168-64207190 TGCCCCCAGAGCCTACCTGCTGG - Intergenic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160523643 18:79522918-79522940 TGCCCCCAGATCCTCCCAGATGG - Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161086693 19:2338743-2338765 GGCCCCCAGGTCCCCCCGGGGGG + Exonic
1161118701 19:2513229-2513251 GCCGCCCAGGTCCTCCGTGCAGG - Exonic
1161421236 19:4176952-4176974 CGCCCCCAGATCCCCCCAGGAGG + Intronic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1163383718 19:16986161-16986183 GCCCCCCAGTTCCCCCCTGCCGG + Intronic
1164065046 19:21708055-21708077 GGCCCCCCCAACCTCCCTCCCGG - Intergenic
1165035034 19:33026711-33026733 TGTGCCCTGATCCTCCCTGCAGG - Intronic
1165357372 19:35312319-35312341 GGCCCCCGGAACCTACCTCCTGG - Intronic
1165592116 19:36977929-36977951 GTCCCCCAGCTCCTACCTTCTGG + Intronic
1165933734 19:39376562-39376584 TGCCCCCAGCACCTCCCTGATGG - Intronic
1166147889 19:40849882-40849904 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166152022 19:40881653-40881675 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166390377 19:42406088-42406110 GGTCCCCAGCCCGTCCCTGCAGG + Intronic
1166638570 19:44473721-44473743 GGCTCCCACATACTCCCTGGGGG - Intergenic
1166658602 19:44630185-44630207 TGGCCCCAGTTCCTCCCAGCTGG - Intronic
1166951094 19:46428531-46428553 TGCCCCCAGCCCCTGCCTGCAGG + Intergenic
1167594155 19:50418571-50418593 GGCCCCCAGCCCGCCCCTGCTGG + Intronic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1168092563 19:54095582-54095604 GGCCCCCAGCCCCTCCTTCCTGG - Exonic
1168289496 19:55350614-55350636 GTCCCCCAGGTCCTGCCAGCTGG - Exonic
1168323064 19:55521770-55521792 GGCTCCCAGCCCCTCTCTGCAGG + Intergenic
925132455 2:1503491-1503513 GGACCCCACATCCTCACTGGCGG + Intronic
925384640 2:3453538-3453560 TGCACCCACACCCTCCCTGCTGG - Intronic
925489676 2:4377466-4377488 GGCCCCCAGTTCATTCCTGCAGG - Intergenic
925591763 2:5516938-5516960 GGCTCCCTGCTCCTCCCTCCAGG - Intergenic
926095812 2:10080153-10080175 AGCCCCGAGAGCCTCCCCGCGGG - Exonic
928370732 2:30738353-30738375 GGCCCCATCCTCCTCCCTGCTGG - Intronic
928692846 2:33818963-33818985 GCCTCCCAAATCCTCCCTCCTGG + Intergenic
929897293 2:45973189-45973211 GTCCCCAAGAACCTCCCTACTGG - Intronic
930087594 2:47508819-47508841 GTCTACCACATCCTCCCTGCTGG - Intronic
930620948 2:53643153-53643175 GGCTCCCAGGTCCTCCCACCTGG - Intronic
930665501 2:54095916-54095938 GGCCCCCACCTCCTCCCGGATGG + Intronic
931670414 2:64642276-64642298 GGGGCCCAGATTCTCCTTGCTGG + Intronic
932397043 2:71455502-71455524 GACTCCCATGTCCTCCCTGCTGG - Intronic
932682248 2:73836354-73836376 AGCCTCCAGATGCTGCCTGCTGG - Intronic
934714702 2:96536873-96536895 GGCACCTTGAACCTCCCTGCAGG - Intronic
934864213 2:97791494-97791516 GGGCCCAAGCTCCTCCTTGCTGG - Intronic
935171613 2:100614734-100614756 GCCCTCCAGGGCCTCCCTGCTGG - Intergenic
935696705 2:105776734-105776756 GGCTCCCAGCTCCTGGCTGCAGG + Intronic
937077364 2:119116985-119117007 TGCCCCCTCGTCCTCCCTGCTGG - Intergenic
937875362 2:126821127-126821149 GGCCTCCAGCTCCTCCCTCCTGG - Intergenic
938370219 2:130763760-130763782 TGCCCACAGCTCCTGCCTGCTGG - Exonic
938501545 2:131833431-131833453 GCCTCCCAGATCCTGCCTGTGGG + Intergenic
940023587 2:149181475-149181497 GGCCCCCAGCCACTCTCTGCTGG + Intronic
944273138 2:197805116-197805138 CGGCGCCGGATCCTCCCTGCCGG - Exonic
947214705 2:227739523-227739545 GACCCCCACATTCTCACTGCCGG + Intergenic
947854590 2:233314503-233314525 GCCCTCAAGATCCACCCTGCGGG - Intronic
948151385 2:235747495-235747517 GGGCCCCATGCCCTCCCTGCAGG + Intronic
948650968 2:239443509-239443531 GGCCCCCAGTTCTTTCCTGTTGG + Intergenic
948689708 2:239694171-239694193 GGCCCCCACTTCCTCCCTCCCGG - Intergenic
1168896777 20:1329069-1329091 GGCCCCCAGCGCTTACCTGCAGG + Intronic
1169118633 20:3082860-3082882 GGGGCCCACACCCTCCCTGCCGG + Intronic
1170064114 20:12292244-12292266 GGCCACCAGTTGCTTCCTGCGGG - Intergenic
1171311923 20:24151490-24151512 GGCTCCCAGCTCCCTCCTGCTGG + Intergenic
1173308621 20:41875530-41875552 TGCCCCCAGAACCTTCATGCAGG - Intergenic
1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG + Intergenic
1173519975 20:43692135-43692157 GGCCCCCTGCTGCCCCCTGCAGG + Exonic
1173525808 20:43731737-43731759 GCCCCCCAGAGCATCCCTGGAGG + Intergenic
1173582087 20:44154616-44154638 GGCTTCCAGCTCCTCCCTCCGGG - Intronic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1174137153 20:48387501-48387523 TGCCCACAGATCATCACTGCTGG - Intergenic
1175326847 20:58135500-58135522 AGCCCCCACCGCCTCCCTGCTGG - Intergenic
1175531307 20:59675406-59675428 AGAGCCCAGATCCTTCCTGCAGG - Intronic
1175783540 20:61698280-61698302 AGGCCCCAGATCCGTCCTGCTGG + Intronic
1176199674 20:63854702-63854724 GGCCCCCAGATCCTGTCTTGAGG + Intergenic
1176876179 21:14131247-14131269 GGCCCCAAAATCATCCCTCCAGG + Intronic
1177743354 21:25180387-25180409 GTCCCCTAGATCATACCTGCTGG - Intergenic
1179442856 21:41407711-41407733 TCCCCACAGCTCCTCCCTGCTGG - Intronic
1180190861 21:46161833-46161855 GGCCCCCAGATCTTGGCTCCTGG - Intronic
1180244654 21:46539020-46539042 GTCCCCCACATCCTCCCAGGAGG + Intronic
1180877402 22:19181037-19181059 GGCCCCCAGAGCTTCCCAGTGGG + Intronic
1180883765 22:19225082-19225104 GGCCCAAAGAGCCTCCCTCCTGG + Intronic
1182099286 22:27646422-27646444 ATCACCCAGGTCCTCCCTGCTGG + Intergenic
1182145656 22:27995263-27995285 GGACCCCAGGGCCTCCTTGCAGG - Intronic
1182462131 22:30490566-30490588 GGGCCACAGCTCCTCCCTGCAGG - Intronic
1182462391 22:30491871-30491893 GGGCCGCGGCTCCTCCCTGCAGG - Exonic
1182467357 22:30525648-30525670 GGGCCGCGGCTCCTCCCTGCAGG - Exonic
1182847906 22:33446671-33446693 GGCCCCCAGACCAGCCCTCCTGG - Intronic
1183196750 22:36358705-36358727 GGCCCACAGGCCCTCCCTTCTGG + Intronic
1183322904 22:37176018-37176040 GTGCCCCAGCTCCTCCCTGCTGG + Intergenic
1183384838 22:37508879-37508901 GTACCCCAGATACTCCCTGGAGG - Intronic
1183535572 22:38398749-38398771 GGCCCCTAAATCCTCCGGGCGGG - Intergenic
1184412483 22:44332926-44332948 GGCCCCAAGATCCTCCCACCTGG + Intergenic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1184973312 22:48043247-48043269 GGCGGCCTGGTCCTCCCTGCGGG - Intergenic
1185150468 22:49161116-49161138 GGCCCAGAGACCTTCCCTGCTGG + Intergenic
1185173143 22:49305054-49305076 GGCACCCAGGTCCCCACTGCAGG + Intergenic
1185380570 22:50505870-50505892 GGCACCCACCTCCACCCTGCAGG + Intronic
1185398927 22:50606041-50606063 ATCCCCCAGACCCTCCCTGGAGG - Intronic
949545519 3:5069032-5069054 GGGCCCCAGGCCCTCCGTGCAGG + Intergenic
950069642 3:10141975-10141997 GGCGCCCAGTTCCTCCGGGCCGG - Exonic
950478834 3:13232286-13232308 GCCCCCCAGATCCTGCTAGCTGG - Intergenic
950546335 3:13640201-13640223 GGCCCCCAGAACGTCCTGGCTGG - Intergenic
952947656 3:38490251-38490273 GTCCCCCAGACCCTGCCCGCTGG + Exonic
953163796 3:40446174-40446196 GGCTCCCATATCTTGCCTGCTGG - Intergenic
954134803 3:48577012-48577034 GGTCCCCAGGTTCTCCCTGTGGG + Exonic
961325218 3:126105471-126105493 GGCCCCCAGTGCCTCCTGGCTGG + Intronic
961481058 3:127181040-127181062 GTCGCCCAATTCCTCCCTGCAGG - Intergenic
962316426 3:134362333-134362355 GGATCCCAAATCCTCCCTGGAGG - Intronic
966887021 3:184382479-184382501 GGCCCCCAGACCTCCCCTGAAGG - Exonic
966930614 3:184673255-184673277 GCCCCCAAGCTCCTCCCTGTGGG + Intronic
968081200 3:195847878-195847900 GGCCCCCACACCCTTCCTGGGGG + Intergenic
968125928 3:196160261-196160283 GGCCCCTCCTTCCTCCCTGCTGG + Intergenic
968815792 4:2820992-2821014 GGTCCCCAGGTCCTGGCTGCAGG - Intronic
968932241 4:3587273-3587295 GGCCCTTGGATCCTCCCGGCTGG + Intronic
968950940 4:3691062-3691084 GGCCCCCAAGCCCTACCTGCAGG - Intergenic
969529953 4:7725143-7725165 GGTCCCCACAGCCCCCCTGCAGG + Exonic
970691966 4:18630698-18630720 GGCCCCCAGCCCTGCCCTGCAGG + Intergenic
971957144 4:33435304-33435326 GGCTCAAAGATCCTCCCAGCTGG + Intergenic
972360125 4:38319018-38319040 GAGCCCCAGCTCCTCCCAGCCGG + Intergenic
984285364 4:177721892-177721914 GGTCCCCAGATCCTTTCTGCAGG + Intergenic
985654498 5:1122942-1122964 CGCCCCCAGCTCCTCCCAGAGGG - Intergenic
985907819 5:2854788-2854810 TGGCTCCAGCTCCTCCCTGCAGG + Intergenic
986441537 5:7786963-7786985 GACCCCATGACCCTCCCTGCTGG - Intronic
986514737 5:8549349-8549371 GACCCCCACATCAACCCTGCAGG + Intergenic
986718049 5:10538164-10538186 GTCCCCAAGAGCCTCCCTCCAGG - Intergenic
987298002 5:16571149-16571171 GGCACCCATCTCCTCCCTGATGG - Intronic
990450688 5:55929475-55929497 GGACCCCAGAACCTCACGGCAGG + Intergenic
992561686 5:77958340-77958362 GGCCCCTAAATCATCTCTGCGGG - Intergenic
992914032 5:81429870-81429892 TGTTCTCAGATCCTCCCTGCGGG - Intronic
995445389 5:112237004-112237026 GGAACCCAGATCCTCACTGTAGG - Intronic
995561604 5:113387997-113388019 GGCCCACCCTTCCTCCCTGCTGG + Intronic
997370811 5:133358462-133358484 GGCCCCCTCGCCCTCCCTGCTGG - Intronic
998256262 5:140591202-140591224 GACCCCCAGAACCTCCATGTGGG + Intronic
998339843 5:141407918-141407940 GGCGCCCAGAGGCTCCGTGCGGG - Intronic
1001984232 5:176060654-176060676 GGCCCCGGGATCCGCGCTGCTGG - Intronic
1001999831 5:176191483-176191505 AGCCCCCAGGTCATCTCTGCAGG - Intergenic
1002081697 5:176741270-176741292 GGACCCCAGATCCTAGCTGCGGG - Intergenic
1002233243 5:177783411-177783433 GGCCCCGGGATCCGCGCTGCTGG + Intronic
1002262735 5:178006370-178006392 GGCCCCGGGATCCGCGCTGCTGG - Intergenic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1002432927 5:179213516-179213538 GGCCCCCAGCTCGCCTCTGCTGG - Intronic
1003444212 6:6169944-6169966 GGCCCCCAGGTCCTGCCTTTTGG + Intronic
1004720395 6:18264038-18264060 GGCCGCCCGGTCCTGCCTGCGGG - Intronic
1006096232 6:31658524-31658546 GATCACCAGATCCGCCCTGCAGG + Exonic
1006167106 6:32071422-32071444 GGCTCCCACATCCACCCTGCAGG + Intronic
1006257417 6:32842904-32842926 GCTCCCCAGATTCTGCCTGCTGG + Intronic
1006259082 6:32853495-32853517 GCCCCGCATATTCTCCCTGCTGG - Exonic
1006509754 6:34515525-34515547 TGACACCAGAGCCTCCCTGCTGG + Intronic
1006523254 6:34584141-34584163 TGCCCCCACACACTCCCTGCTGG - Intergenic
1006798069 6:36743570-36743592 GGCTCCCAGTGCCTCCCTTCTGG + Intronic
1007165221 6:39824297-39824319 GACCCCAAGATGCCCCCTGCTGG - Intronic
1007932195 6:45701778-45701800 AGCCTCCAAATCATCCCTGCAGG + Intergenic
1009645193 6:66393465-66393487 GGCCACCATTTTCTCCCTGCAGG - Intergenic
1013681613 6:112530254-112530276 GGCCTCCAAATCCTCACTGATGG - Intergenic
1014088359 6:117373427-117373449 GGGCCTCAGCGCCTCCCTGCGGG - Intronic
1015826601 6:137318990-137319012 GGCCACCAGACCATCTCTGCTGG + Intergenic
1016838113 6:148499610-148499632 GGCTCCCAGACCCTCTTTGCTGG - Intronic
1018368889 6:163149585-163149607 GACCCCGCGAGCCTCCCTGCAGG + Intronic
1018813291 6:167313200-167313222 GGTCCCCAAGTCCTCCATGCTGG + Intronic
1019073210 6:169366694-169366716 GGCTGCCACATTCTCCCTGCTGG - Intergenic
1019911425 7:4102637-4102659 GGCCACCAGAGCCTCCCAGCAGG + Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1022466670 7:30656719-30656741 GCTCCCCAGCTGCTCCCTGCTGG + Intronic
1023867589 7:44245592-44245614 GGCCCCCAGGTGCTCCCCTCGGG - Intronic
1025004203 7:55342643-55342665 AGCCTCCAGACCCTCCCTGGAGG - Intergenic
1029381685 7:100219534-100219556 GGCTCTCAGGTCCTCCCTGCTGG + Intronic
1029401850 7:100351982-100352004 GGCTCTCAGGTCCTCCCTGCTGG + Intronic
1029543428 7:101198092-101198114 GGCACCCGGATCCCCCATGCAGG + Intronic
1032016008 7:128380858-128380880 GGCCCCCAGCTCACCTCTGCAGG + Intergenic
1033467585 7:141609683-141609705 GGCCCCTCGCTCCTCCCTGGAGG + Intronic
1034899661 7:154899773-154899795 GGACCCCAGGTACTGCCTGCTGG + Intergenic
1037886742 8:22599589-22599611 GGCCCCCAGACACTCCCAGCGGG - Intronic
1037987693 8:23299910-23299932 GGCCCCCAGAACAGCCCCGCTGG - Intronic
1040870954 8:52100176-52100198 GGCCCCCAGAGCTCCCCTGTCGG - Intergenic
1041101006 8:54396396-54396418 TGTCACCACATCCTCCCTGCAGG - Intergenic
1041381606 8:57258867-57258889 GGCCCTGCGGTCCTCCCTGCTGG - Intergenic
1042020575 8:64369409-64369431 GGCCCGCAGCTCCTCGCGGCCGG + Intergenic
1043388430 8:79768935-79768957 GGCGGCCAGATCCTCTCAGCGGG + Intergenic
1045314267 8:101029573-101029595 GGCCCCCAGAGCCTCTCGTCTGG - Intergenic
1049169679 8:141151780-141151802 GGCCCCCACGTCCTTCCTGATGG + Exonic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1049744466 8:144257399-144257421 GGCCCCCAGCACCTCCTTCCTGG + Intronic
1051094108 9:13445354-13445376 AGCCTTCACATCCTCCCTGCGGG - Intergenic
1053284057 9:36839203-36839225 GTCCCCCAGATCTTCCCTGCTGG + Exonic
1055923150 9:81482848-81482870 GGCCTGCAAATCCTCACTGCTGG + Intergenic
1057141352 9:92728459-92728481 CCCACCCAGACCCTCCCTGCGGG + Intronic
1057186866 9:93061985-93062007 GGCCCCTCCATCCTCCCTCCTGG - Intronic
1057962168 9:99467333-99467355 GGCCTCCAGATCATCCCTTCTGG + Intergenic
1058774210 9:108267934-108267956 GACCCTCAGATCCTGTCTGCTGG + Intergenic
1060666033 9:125432767-125432789 GGGCCCCAGAGCTTCCCTGGAGG + Intergenic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061678857 9:132232711-132232733 CCCCACCAGGTCCTCCCTGCAGG - Intronic
1062006151 9:134239524-134239546 GGCCCTCACCTCCTCCCTGCCGG + Intergenic
1062025607 9:134338847-134338869 AGCCCAGAGATCCTCCCTCCAGG + Intronic
1062449773 9:136610571-136610593 CGCCCCCACGTCCACCCTGCTGG + Intergenic
1062459480 9:136656920-136656942 GGCCCCCAGATCTCCCCAGGCGG + Intergenic
1062501890 9:136855245-136855267 TGCCCTCAGATCCTCCTGGCCGG + Exonic
1187735668 X:22301534-22301556 GGCCCCCACTTTCTCCCAGCAGG + Intergenic
1189251194 X:39601707-39601729 GGCCCCCAGCCCCCGCCTGCTGG + Intergenic
1189268090 X:39731514-39731536 GTCACCCAGCTCCTCCCTGGTGG - Intergenic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1190493319 X:51003964-51003986 GGCCCCTAGATCCTCACTCCTGG + Intergenic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1199600930 X:149540613-149540635 TTCTCCCAGCTCCTCCCTGCTGG + Intronic
1202369883 Y:24189264-24189286 GGCCGCCAATGCCTCCCTGCTGG - Intergenic
1202500901 Y:25480853-25480875 GGCCGCCAATGCCTCCCTGCTGG + Intergenic