ID: 1192082523

View in Genome Browser
Species Human (GRCh38)
Location X:68062149-68062171
Sequence TAGGATAGCAAGGAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192082523_1192082531 9 Left 1192082523 X:68062149-68062171 CCTGCCATTTCCTTGCTATCCTA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1192082531 X:68062181-68062203 AACCTCCCGATTCCCATTCTGGG 0: 1
1: 0
2: 2
3: 5
4: 75
1192082523_1192082530 8 Left 1192082523 X:68062149-68062171 CCTGCCATTTCCTTGCTATCCTA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1192082530 X:68062180-68062202 CAACCTCCCGATTCCCATTCTGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192082523 Original CRISPR TAGGATAGCAAGGAAATGGC AGG (reversed) Intronic
900385220 1:2407504-2407526 TAGGACAGCCAGGAAGTGGCTGG - Intronic
900722179 1:4184111-4184133 TAGGATGGAAAGGAAATGAGAGG + Intergenic
903768614 1:25750169-25750191 TGGGATAGGAAGGAAAGGGTGGG + Intronic
904761290 1:32806083-32806105 CAGGAGAGTGAGGAAATGGCTGG + Intronic
904959565 1:34321529-34321551 AATGATATCAAGGAAATGACAGG + Intergenic
906549737 1:46654281-46654303 TAGTATAGCTAGTAAATGACTGG - Intronic
909929153 1:81475074-81475096 TAGGAAACCAAGGAAATAGAAGG - Intronic
911555270 1:99337274-99337296 TTGGAGAGCAAGCAAATGGGAGG - Intergenic
916208703 1:162340662-162340684 GAGGATAGGAAGGAAATGGGAGG + Intronic
919413184 1:197272910-197272932 TAGGAAATCAAGGAAATCCCAGG + Intronic
924003243 1:239577210-239577232 AAGGAAAGGAAGGAAAAGGCTGG - Intronic
1064870051 10:19927403-19927425 TATAAAAGCAAGGAATTGGCTGG + Intronic
1065212904 10:23421924-23421946 TTGGAAAGCAAGGATATGTCAGG + Intergenic
1067963649 10:50885042-50885064 TTGGTTAGCAAGATAATGGCAGG + Intronic
1069984943 10:72276638-72276660 TTAGAGAGCAAGGAAATAGCAGG + Intergenic
1073733236 10:106316093-106316115 TAAGAAAGAAAGAAAATGGCAGG + Intergenic
1080362260 11:31529545-31529567 GAGGTTAGCAGGGAATTGGCTGG - Intronic
1083863802 11:65442444-65442466 CAGGCTATGAAGGAAATGGCTGG + Intergenic
1084634597 11:70382684-70382706 TAGAACAGCAAGGAGAGGGCGGG - Intronic
1086993760 11:93333459-93333481 GAGTATAACATGGAAATGGCAGG + Intronic
1088024493 11:105161455-105161477 GAGGATTGAAAGGAAAAGGCAGG + Intergenic
1088377799 11:109160859-109160881 TAGAATAGCAAGGGAAAGACTGG + Intergenic
1089275849 11:117335548-117335570 TGGCCTAGAAAGGAAATGGCTGG - Intronic
1090618174 11:128535732-128535754 TAAAATAGCAAGGAAAGAGCTGG - Intronic
1091910083 12:4223398-4223420 TAGGATAGCAAGACAGGGGCAGG - Intergenic
1092203804 12:6603512-6603534 TAGGACAGACAGGAAGTGGCAGG + Intronic
1092324503 12:7515548-7515570 AAGGTTAGACAGGAAATGGCTGG + Intergenic
1093876178 12:24352141-24352163 TAGGATAGCAATGAATGGGCAGG + Intergenic
1098429107 12:70400301-70400323 TAAAATAGCAAGTAAATGGCTGG - Exonic
1101503200 12:105323304-105323326 TAGTGCAGCAAGGAAATTGCAGG + Intronic
1102037981 12:109783001-109783023 TGGGAGAGCTAGGAAATGCCTGG - Intergenic
1102552091 12:113698783-113698805 GAGGATAGTAGGGAAAGGGCTGG + Intergenic
1102578087 12:113869731-113869753 TAAGATAACAAGCAAACGGCTGG - Intronic
1104275601 12:127324225-127324247 TAGAATTGGAAGGAAATTGCTGG + Intergenic
1104702835 12:130920232-130920254 TAGCAGAGAAAGGGAATGGCTGG - Intergenic
1107595791 13:41961363-41961385 TGGGATCGCAGGGAAACGGCGGG - Intergenic
1110749866 13:79100734-79100756 TAGGAAAGCAAGCCAATTGCTGG - Intergenic
1112889005 13:104209186-104209208 TAGGATGGAAAGGAAATGAGAGG + Intergenic
1114150315 14:20031258-20031280 AAGGAGAGCAAGTGAATGGCAGG + Intergenic
1116490253 14:45496465-45496487 TAGGATGGAAAGGAAATGAGCGG + Intergenic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1118694036 14:68366667-68366689 TTGAATAGCAAGAAACTGGCAGG + Intronic
1118757854 14:68858271-68858293 TAGGATATAAAGGAAATTGTAGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1122834465 14:104424109-104424131 TAGGACAGCAAGGAATGGGCAGG - Intergenic
1125233801 15:37487863-37487885 TAGGAAAGAAAGCAGATGGCAGG - Intergenic
1127474304 15:59318206-59318228 TAGGATTGTAAGATAATGGCTGG - Intronic
1129532399 15:76279079-76279101 TAGGGAAGCAGGGAAATGGATGG - Intronic
1129934308 15:79436938-79436960 TAGGACACAAAGTAAATGGCAGG - Intronic
1129991796 15:79971824-79971846 TAGGATAGAAAGCAAATTGGTGG + Intergenic
1130862533 15:87903786-87903808 TGGGATAGCAATGAAAAGGGGGG + Intronic
1131397460 15:92097927-92097949 TAGGAAAGCAAGGAAAAGATAGG - Intronic
1133554907 16:6896820-6896842 TAGGATAGAAAGAAGATTGCAGG + Intronic
1135252842 16:20915606-20915628 CAGGCTTGCGAGGAAATGGCAGG + Exonic
1140170804 16:72601766-72601788 AAGGAAAGCAAGGAAACGGATGG + Intergenic
1141296976 16:82779009-82779031 CCGGAAAGCAAAGAAATGGCTGG + Intronic
1142711897 17:1728017-1728039 GAGGAGAGCAAGGACCTGGCAGG + Exonic
1142872391 17:2829278-2829300 CAGGAAAGCAAGTAATTGGCCGG - Intronic
1143539108 17:7558980-7559002 TGGGGTAGCAAGGAGGTGGCGGG - Exonic
1143944762 17:10581094-10581116 TGGAATAGGAAGGAAAAGGCTGG + Intergenic
1144008122 17:11119570-11119592 GAGAATAGCAGGGACATGGCAGG + Intergenic
1150457037 17:65314422-65314444 TAGGAAACCAGGAAAATGGCAGG - Intergenic
1203197925 17_KI270729v1_random:249230-249252 TAGCATAGAAAGGAATTGGACGG + Intergenic
1203207529 17_KI270730v1_random:49984-50006 TAGCATAGAAAGGAATTGGACGG + Intergenic
1155700988 18:28743367-28743389 CAGGAAAGCAAGGAAACTGCAGG + Intergenic
1156873451 18:41976124-41976146 TAAGATAGCAAGGAATTTTCTGG + Intronic
1157611808 18:48961728-48961750 TAAGAAAGTAAAGAAATGGCAGG + Intergenic
1157697666 18:49736014-49736036 TAGTATACCCAGGAAAGGGCCGG + Intergenic
1159986617 18:74849372-74849394 TAGAAAAGCAAAGAAACGGCGGG - Intronic
926904187 2:17790630-17790652 TTGGAGAGTAAGGAAATGACTGG - Intronic
927598438 2:24418793-24418815 TAGGACAGAAAGGACATGGTAGG + Intergenic
929249293 2:39735184-39735206 TAGGTTAACAAGGTAATGGGTGG - Intergenic
931062661 2:58548410-58548432 GAGGATAGTAAGGAAATGAAGGG - Intergenic
933247320 2:79990131-79990153 TAGGACAACAAGGGGATGGCAGG + Intronic
935981075 2:108628256-108628278 TAGGAAAACTAGGAAAAGGCAGG - Intronic
936373255 2:111920318-111920340 AAGGAAAGGAAGTAAATGGCTGG - Intronic
936941568 2:117889627-117889649 TAGGTCAGCAGAGAAATGGCTGG + Intergenic
940767759 2:157808378-157808400 TAGCCTAGCAAGGAAATGGGGGG + Intronic
941011033 2:160299555-160299577 TAGGAGAGCAAGGCAATGACTGG + Intronic
941935582 2:170979070-170979092 TATGATAGAAAGGAAATGAGAGG + Intergenic
946449761 2:219769793-219769815 CAGGATAGCAAAGAATTGGCTGG - Intergenic
948336296 2:237209842-237209864 TAGGATAACAATAAAAAGGCAGG + Intergenic
1170499337 20:16958537-16958559 GAGGACAGCAAAGAAATGTCCGG + Intergenic
1170798293 20:19569449-19569471 AAGGATGGAAAGGAAATGGGAGG - Intronic
1171069826 20:22057780-22057802 AAGAATAGCAAGGAAAAGACTGG - Intergenic
1172783017 20:37448266-37448288 TAGGAGAGGAAGAAAATGGAAGG - Intergenic
1174889937 20:54380991-54381013 TAGGATGGAAAGGAATTGGAAGG - Intergenic
1176016268 20:62934875-62934897 AAGGGTAGCAAGAAAGTGGCCGG - Intronic
1177581370 21:23026476-23026498 TAGTTTAGCAAGGAAATGATCGG + Intergenic
1178575961 21:33791669-33791691 TAGTATAGAAAGGAAATGTGCGG + Intronic
1179152911 21:38823913-38823935 GAGCACAGGAAGGAAATGGCTGG - Exonic
1181271619 22:21661933-21661955 GAGGATAGAAAGGAAATCTCAGG + Intronic
1184845772 22:47084859-47084881 TAGAATCTCATGGAAATGGCTGG + Intronic
950902264 3:16508506-16508528 TTGGAGAGCAAGGAATTAGCCGG + Intronic
951575423 3:24108452-24108474 CAGAGTAACAAGGAAATGGCAGG - Intergenic
951830619 3:26922269-26922291 TAGGAAAGCAAAGAAAGGTCTGG - Intergenic
961143973 3:124578839-124578861 AAGGAGAGCAAGGGAATGGTTGG + Intronic
961457397 3:127031048-127031070 GAGGAAAGCAAGGGACTGGCTGG - Intronic
961966046 3:130903810-130903832 TAGGATGGCAACAAAATGGACGG + Intronic
962881154 3:139578003-139578025 TAGGATTGGCAGGAAATGGGAGG - Intronic
965732931 3:171791924-171791946 TCTGAAAGGAAGGAAATGGCAGG - Intronic
968209648 3:196838110-196838132 GAGGATAGCAGGGCAATGGCAGG - Intergenic
969653752 4:8484048-8484070 CAGGATGGAAAGGAAATGACAGG + Intronic
972339831 4:38142427-38142449 GAGGAAAGCAAGCAAATGACTGG - Intergenic
973662562 4:53123187-53123209 TAGGATAGGGTGGAAATGGGGGG - Intronic
974095822 4:57362655-57362677 GAGACTAGCAAGGAAATAGCAGG - Intergenic
974850431 4:67398164-67398186 TAGGTTAGCCAGAAGATGGCTGG + Intergenic
975960374 4:79897065-79897087 TAGGAAAGGAAGGAAAAGGAAGG + Intergenic
977914778 4:102579094-102579116 TCAGCTAGCAAGTAAATGGCAGG - Intronic
978706422 4:111718068-111718090 TAGGACAGCAATGAAAAGGCTGG + Intergenic
978924566 4:114227239-114227261 TAGGACAGCTGGGAAATGTCAGG - Intergenic
982642471 4:157980359-157980381 CATAATAGCAAGCAAATGGCTGG - Intergenic
985901525 5:2798976-2798998 CAGGATGCCTAGGAAATGGCTGG - Intergenic
986229014 5:5844373-5844395 TAGGAAAATAAGAAAATGGCCGG - Intergenic
986476559 5:8139823-8139845 TAAGATTAAAAGGAAATGGCAGG - Intergenic
987225419 5:15835234-15835256 GAGGAAAGAAATGAAATGGCCGG + Intronic
988908979 5:35820712-35820734 TAGGACAGCAACTAAGTGGCTGG - Intergenic
990397291 5:55395107-55395129 TAAAATATAAAGGAAATGGCTGG + Intronic
992874285 5:81037396-81037418 TAGGATAGCATTGAAGTTGCCGG - Intronic
994056904 5:95427190-95427212 AAGGATAGAAGGGAGATGGCAGG + Intronic
995300140 5:110570530-110570552 TAGAAGAGTAAGGAAAGGGCTGG + Intronic
996352781 5:122563968-122563990 TAGGATAGCAGGAATATGGCAGG + Intergenic
997741856 5:136262104-136262126 TTAGACAGGAAGGAAATGGCTGG - Intronic
998648300 5:144089290-144089312 AGGGATAGAAAGGACATGGCTGG - Intergenic
999211035 5:149888785-149888807 TAAGATTGGAAGAAAATGGCTGG + Intronic
999916626 5:156269544-156269566 GAGGATAGCATGGGAAAGGCTGG + Intronic
1001699481 5:173696435-173696457 TTGCACAGCTAGGAAATGGCAGG + Intergenic
1004462432 6:15850252-15850274 TAGGATAACTGGGAAAGGGCGGG - Intergenic
1005939420 6:30549782-30549804 TAGGAGAGAAAGGAAATAGTTGG - Intronic
1006455628 6:34130298-34130320 CAGGACAGCAAGGAAAGGGAGGG - Intronic
1007313998 6:40969718-40969740 TTGTACAGCAAGGAAATGGTGGG - Intergenic
1008182162 6:48344358-48344380 TTGGACAGAAAGGAAATGCCTGG - Intergenic
1008222005 6:48865584-48865606 TAGGGTAGCAAGGAGAAGGAAGG + Intergenic
1008391585 6:50958535-50958557 TAGGAGACCAAGAAAATGCCAGG + Intergenic
1009937774 6:70253838-70253860 TAGGAGAAAAAGGAAATGGTAGG + Intronic
1012709262 6:102578790-102578812 AAGTATAGCAAGGAATAGGCAGG - Intergenic
1014116442 6:117673328-117673350 GAGGAAAGCAAGCAAATGTCTGG + Intergenic
1015076524 6:129165602-129165624 TTGGATCGCAATGACATGGCTGG - Exonic
1015230310 6:130907676-130907698 TAGGGAAGCAAAGAAATGACAGG + Intronic
1015801022 6:137062220-137062242 TAGGATGGAAAGGAAATGAGAGG + Intergenic
1016202434 6:141429446-141429468 GAGAATAGCAAGGAAAAGACTGG + Intergenic
1020437807 7:8184776-8184798 TAAGATAGAAAAGAAAAGGCGGG + Intronic
1021128666 7:16883896-16883918 TTGCAAAGCAAAGAAATGGCTGG + Intergenic
1021430184 7:20550065-20550087 TAGGATGGAAAGGAAATGAGAGG - Intergenic
1022848678 7:34237326-34237348 CAGGAGAGCAGGGAAATGGGAGG + Intergenic
1024391429 7:48817242-48817264 TATGATAGAAAGGTAATGGGAGG - Intergenic
1026039992 7:66860107-66860129 CAGGAAAGCAGAGAAATGGCAGG - Intergenic
1029031012 7:97467030-97467052 TAGGATAGCAAGCAAGTGAATGG + Intergenic
1030130481 7:106195401-106195423 TGGGATATCAAGGACATAGCTGG - Intergenic
1030431133 7:109450678-109450700 TCTCATAGCAAGGAAATGCCTGG - Intergenic
1031866427 7:127042343-127042365 CAGAAGAGCAAAGAAATGGCAGG + Intronic
1032438921 7:131926810-131926832 TAGGTTACCAAGGAAAGGCCTGG - Intergenic
1032846709 7:135757513-135757535 TAAGATAGATAGGAAATGGGAGG - Intergenic
1033366252 7:140674091-140674113 TTGGATACCTTGGAAATGGCCGG + Exonic
1035206675 7:157298163-157298185 TAGAAGAAGAAGGAAATGGCTGG + Intergenic
1037967113 8:23143582-23143604 TAGGAAAGGAAGAAAATGGGTGG + Intronic
1041409243 8:57535279-57535301 AAGGAAAGCCAGGAGATGGCTGG - Intergenic
1043138052 8:76552511-76552533 TAGGAAAGCAAGAAGTTGGCCGG - Intergenic
1043909126 8:85840064-85840086 GAGGTTGGCAAGGAAATGGCAGG - Intergenic
1044592641 8:93929128-93929150 TAGAAAAGCAGGGAACTGGCTGG - Intergenic
1045885670 8:107095180-107095202 CAGGATAGCAATGAAATAGATGG + Intergenic
1045921328 8:107533261-107533283 GAGAACAGCAAGGTAATGGCTGG + Intergenic
1047056302 8:121168300-121168322 TAGAAAAGCAAGTAGATGGCCGG - Intergenic
1049787675 8:144458827-144458849 CAGGAGAGCATGGGAATGGCAGG + Intronic
1054960412 9:70962021-70962043 GATGATAGGAAGGAAATGGTAGG + Intronic
1055638835 9:78303663-78303685 TAGGATAGCAAGCAACCAGCAGG - Intronic
1056826443 9:89879400-89879422 TGGGATGTCAAGGAAAGGGCAGG - Intergenic
1059472132 9:114513531-114513553 GAACATAGCAAGTAAATGGCCGG + Intergenic
1061860875 9:133468250-133468272 AAGGATAGCAAAAACATGGCTGG + Intronic
1187554987 X:20343126-20343148 TAGGAAGGCATGGGAATGGCTGG + Intergenic
1188531320 X:31144526-31144548 TAGGACAGAAAGGAAAAGTCAGG - Intronic
1189356034 X:40310559-40310581 CAACGTAGCAAGGAAATGGCAGG - Intergenic
1189499350 X:41540965-41540987 TAGAAAAGCAAAGAAATGGCTGG - Intronic
1189922005 X:45911531-45911553 TAGGAAAAGAAAGAAATGGCAGG - Intergenic
1192082523 X:68062149-68062171 TAGGATAGCAAGGAAATGGCAGG - Intronic
1192696248 X:73419058-73419080 TAGGGTAGCTAGGAAGTGTCTGG - Intergenic
1196382486 X:115106556-115106578 AAGAATAGCAAGAAAATGGACGG + Intergenic