ID: 1192087003

View in Genome Browser
Species Human (GRCh38)
Location X:68110033-68110055
Sequence CCAGCAAAACAGCGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192087003_1192087007 11 Left 1192087003 X:68110033-68110055 CCTGTTTTACGCTGTTTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1192087007 X:68110067-68110089 ACTGAATGTGTAGATTTGTTAGG 0: 1
1: 0
2: 22
3: 509
4: 2684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192087003 Original CRISPR CCAGCAAAACAGCGTAAAAC AGG (reversed) Intronic
902913451 1:19619706-19619728 CCAACAGAACATCATAAAACCGG - Intronic
904467593 1:30717746-30717768 CCAGGAAAACGGCGTGAACCCGG - Intronic
907948210 1:59155197-59155219 CCAGCAAAACAACAAAAAATAGG + Intergenic
908641224 1:66225762-66225784 CCAGGAAAACAAAATAAAACAGG - Intronic
913381279 1:118213400-118213422 CCACCAAAACAGCATGATACTGG - Intergenic
913571014 1:120120091-120120113 CCAGAAAAACAGCAGAAGACAGG - Intergenic
914291824 1:146281069-146281091 CCAGAAAAACAGCAGAAGACAGG - Intergenic
914552868 1:148731852-148731874 CCAGAAAAACAGCAGAAGACAGG - Intergenic
918029677 1:180793270-180793292 ACAGCAAGACATTGTAAAACAGG - Intronic
921250081 1:213289416-213289438 CCAACACAACAGCGTGGAACTGG + Intergenic
922932244 1:229399202-229399224 ACAGCCAAACAACGTAACACAGG + Intergenic
1064818733 10:19298804-19298826 CCAGCAAAACATCTTAAATATGG - Intronic
1065705296 10:28466695-28466717 GCAGGAAAATGGCGTAAAACCGG + Intergenic
1074637643 10:115339096-115339118 CAAGCAAAGCAGCATAATACTGG - Intronic
1081022525 11:37965208-37965230 CAAGCAAAATAGAGAAAAACAGG + Intergenic
1083046289 11:59738431-59738453 CCAGCAAAACAGCATGGTACTGG - Intronic
1090918722 11:131189901-131189923 CCAGCATAACAGCATAATAATGG - Intergenic
1090925907 11:131250278-131250300 CCACCAAAAGAAAGTAAAACAGG - Intergenic
1092962461 12:13609150-13609172 ACATCAAAACTGAGTAAAACAGG + Intronic
1103332114 12:120161558-120161580 CCAGCAGGACAGCATAAAAAAGG - Exonic
1105813542 13:24013932-24013954 ACAGCACAACAGCTTAAAACAGG - Intronic
1114052143 14:18929556-18929578 TCAGCAAAACAGCATAATACTGG - Intergenic
1114108472 14:19450604-19450626 TTAGCAAAACAGCATAATACTGG + Intergenic
1114110416 14:19472368-19472390 TCAGCAAAACAGCATAATACTGG + Intergenic
1115095021 14:29624240-29624262 AAAGGAAAACATCGTAAAACAGG - Exonic
1115300279 14:31877664-31877686 CAAGCAAAACAGTGTACAATAGG - Intergenic
1118765612 14:68907615-68907637 ACAGCAAAACAGGGAGAAACTGG + Intronic
1119583393 14:75808673-75808695 CTAGCAAAACAGGTGAAAACAGG + Intronic
1120288950 14:82542058-82542080 TCAGCAAAACAGCATGATACTGG - Intergenic
1120308870 14:82804911-82804933 CAAGCAAAACAGCCAAATACAGG - Intergenic
1123068182 14:105628500-105628522 CCAGAAAAACAGCCCAAACCTGG - Intergenic
1123072189 14:105647279-105647301 CCAGAAAAACAGCCCAAACCTGG - Intergenic
1123097771 14:105774497-105774519 CAAGAAAAACAGCCTAAACCTGG - Intergenic
1124387098 15:29218582-29218604 TCACCAAAACAGCATAATACTGG + Intronic
1125496172 15:40196359-40196381 TCACCAAAACAGCATAATACTGG - Intronic
1125710050 15:41777422-41777444 CCAGGAAAACAGTGGAAAAGGGG + Intronic
1126566302 15:50103848-50103870 GCACCAAAACAGCATAATACTGG + Intronic
1132823292 16:1888456-1888478 TAAGCAAAACAAAGTAAAACAGG + Intergenic
1132994197 16:2814599-2814621 CCAGCAAAACATGGAAAGACAGG - Intergenic
1136645140 16:31607865-31607887 TCACCAAAACAGCATAATACTGG + Intergenic
1138070294 16:53986288-53986310 CCAGCAAATCTGGGTTAAACAGG + Intronic
1142903838 17:3029462-3029484 TCAGCCAAACAGCATGAAACCGG - Intronic
1143874305 17:9980199-9980221 CCAGCAGAAGAGCTCAAAACTGG - Intronic
1152891760 17:82885993-82886015 CCAGTGACACAGCGTCAAACAGG - Intronic
1160146806 18:76371911-76371933 CCAGCAAATCAGAGTGACACCGG + Intronic
1161496010 19:4586066-4586088 CCATCAAAACAGGGTAAAGAGGG - Intergenic
1163947617 19:20554353-20554375 CCAGAAAAACTGGGAAAAACAGG - Intronic
1164244187 19:23416158-23416180 CCAGGAAAACAGGCTAAAGCAGG + Intergenic
1166741886 19:45119451-45119473 CCATCAAAACACAGTTAAACGGG - Intronic
930887205 2:56339773-56339795 CTTGCAAAACAGTGTAAATCAGG + Intronic
930996185 2:57721369-57721391 ACAGCCACACAGCGTCAAACTGG + Intergenic
935389573 2:102536261-102536283 CCAGCATCTCAGAGTAAAACAGG - Intergenic
938470177 2:131552875-131552897 TCAGCAAAACAGCATAATACTGG - Intergenic
938472076 2:131574083-131574105 TCAGCAAAACAGCATGATACTGG - Intergenic
939236949 2:139506947-139506969 CAACCAAAACAGCATAAATCTGG + Intergenic
940139827 2:150481762-150481784 CCAGAAAAGCAGCTTAAAAGGGG - Intronic
942462702 2:176179257-176179279 GCAGCAAAAAAGGGTAAAAGGGG - Intergenic
946293292 2:218762354-218762376 TAATCAAAACAGTGTAAAACTGG - Intergenic
946913829 2:224494514-224494536 CTATCAAGACAGCATAAAACTGG + Intronic
947299812 2:228676462-228676484 CAAGCAAAACAGCCCCAAACAGG + Intergenic
948240266 2:236426007-236426029 AAAGCAAAACAGCGTGATACTGG - Intronic
1171048313 20:21832269-21832291 CCAGCAAGAGAGAGTAAAAGAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173866318 20:46314650-46314672 CCAGCAAAACAGAGGAAGAGAGG - Intergenic
1174149850 20:48478262-48478284 CCATCAAAACAGGGTGACACAGG - Intergenic
1174563468 20:51447608-51447630 CCAGCAAAACATTGCAAAACAGG - Intronic
1179773795 21:43645977-43645999 CCAGCTAAACATCATAAAATTGG + Intronic
1180470615 22:15651929-15651951 TCAGCAAAACAGCATAATACTGG - Intergenic
949266415 3:2161819-2161841 CCATCAAAACAGCAAGAAACAGG - Intronic
955074682 3:55602459-55602481 CCAGGAAAACAACCAAAAACAGG + Intronic
955135297 3:56211718-56211740 TCACCAAAACAGCATAATACTGG + Intronic
960524821 3:118697658-118697680 TCACCAAAACAGCGTGATACTGG + Intergenic
961093319 3:124134147-124134169 TCACCAAAACAGCGTGATACTGG + Intronic
961531839 3:127544752-127544774 CCAGCAAAACTGGGCAAGACAGG + Intergenic
965014895 3:163145361-163145383 TCACCAAAACAGCATAATACTGG - Intergenic
967604189 3:191424803-191424825 CCATCAAAATAGAGTAGAACAGG - Intergenic
978516407 4:109573357-109573379 GCAGCAGAACCGCGTAAACCTGG + Intronic
979683937 4:123490285-123490307 GCAGGAAAACAGCGTGAACCCGG - Intergenic
983045374 4:162980501-162980523 CAAGAAAAACAGCAGAAAACAGG + Intergenic
984138179 4:175968037-175968059 CAATCAAAACAGCGTAATACTGG + Intronic
984406362 4:179336681-179336703 CTAGCAAAACTGCTTAAAACCGG + Intergenic
984675780 4:182545781-182545803 ACAGAGAAACAGAGTAAAACAGG - Intronic
988578280 5:32446793-32446815 CAAGCAAACAAGCATAAAACTGG - Intergenic
991283510 5:64942662-64942684 CAAGCAAAAAAGCTAAAAACAGG - Intronic
993512985 5:88795017-88795039 CAACCAAAACAGCATAATACTGG - Intronic
994090381 5:95804608-95804630 CCAGCAAAACTGGATAAAAATGG + Intronic
995845628 5:116490777-116490799 CCATCACAACAGCTAAAAACTGG - Intronic
996559506 5:124813756-124813778 CCAGTAAAATAACTTAAAACGGG - Intergenic
997061375 5:130507449-130507471 TAAGCCAAACAGCGTAAAACTGG - Intergenic
997103680 5:130995124-130995146 CCAGAAAAACCGCGAAAACCAGG + Intergenic
997605391 5:135172313-135172335 CCACCAAAACAGCATAATATTGG - Intronic
998318684 5:141208949-141208971 CCAGCAAAACAAAGAAAAGCAGG - Exonic
999903072 5:156108157-156108179 CCAGAAAACCAGAGTAAACCAGG + Intronic
1000404474 5:160872749-160872771 TCACCAAAACAGCATAATACTGG - Intergenic
1000757435 5:165179189-165179211 TCAGCAAAACAGCATGATACTGG - Intergenic
1000822093 5:165997550-165997572 GCAGGAGAACAGCGTAAACCCGG - Intergenic
1006400374 6:33814003-33814025 CCAGCAATACAGCGTGATTCAGG - Intergenic
1014537081 6:122627147-122627169 GCAGGAAAACGGCGTAAACCCGG + Intronic
1014792341 6:125687754-125687776 CCAGCAAAACAGCATGATACTGG - Intergenic
1018616009 6:165687655-165687677 GCATAAAAACAGCGTAGAACAGG - Intronic
1022670599 7:32451919-32451941 GCAGGAAAACAGCGTGAACCCGG - Intergenic
1025157248 7:56618698-56618720 CAAGCAAAACAGCATGATACTGG - Intergenic
1026937669 7:74268045-74268067 CCTGCTAAACAGCCTAAAAAGGG - Intergenic
1027980103 7:85207246-85207268 TCAGCCAAACACCGTAAAAGAGG + Intergenic
1030390061 7:108916716-108916738 TCACCAAAACAGCATAATACTGG - Intergenic
1036085789 8:5611439-5611461 CAAACAAAACAGCATAAAACAGG + Intergenic
1044696411 8:94926579-94926601 CAGGCAAAACAGAGCAAAACTGG + Exonic
1049224222 8:141441936-141441958 CCAGCATTTCCGCGTAAAACAGG - Intergenic
1057118941 9:92553285-92553307 TCACCAAAACAGCATAATACTGG - Intronic
1058081888 9:100709745-100709767 CCAGCAAAACAGGGTCAGAGTGG - Intergenic
1059095145 9:111405180-111405202 TAAGCAAAACAGCATGAAACTGG + Intronic
1059175429 9:112166077-112166099 CCAGCAAAAAAACGTAAGATGGG + Intronic
1059517145 9:114906561-114906583 CTAGCAAAATAGCCTAGAACAGG - Intronic
1186369647 X:8933538-8933560 CAATCAAAACAGCGTGATACTGG - Intergenic
1186812916 X:13207723-13207745 CCAGCAATACAGGGGAGAACAGG + Intergenic
1190631798 X:52394470-52394492 TCACCAAAACAGCATAATACTGG - Intergenic
1191017451 X:55825169-55825191 TCAGCAAAAAAGAGCAAAACTGG - Intergenic
1191757224 X:64606759-64606781 CCAGGAAAACAGGGTCAAAGTGG - Intergenic
1191912229 X:66163332-66163354 CCAACAATTCAGGGTAAAACTGG - Intronic
1192087003 X:68110033-68110055 CCAGCAAAACAGCGTAAAACAGG - Intronic
1194178543 X:90684180-90684202 GCAGGAAAACAGCGTGAACCCGG + Intergenic
1196465216 X:115965414-115965436 TCACCAAAACAGCGTGATACTGG + Intergenic
1196539665 X:116892600-116892622 CCAGCAAAACATTGCAGAACAGG - Intergenic
1197382252 X:125759147-125759169 TAACCAAAACAGCATAAAACTGG - Intergenic
1199138702 X:144285066-144285088 ACAGCAAAGCAGCATAAAAAGGG - Intergenic
1199425868 X:147700226-147700248 TCACCAAAACAGCGTGAAACTGG + Intergenic
1199668934 X:150125614-150125636 TCACCAAAACAGCGTGATACTGG + Intergenic
1200525207 Y:4266345-4266367 GCAGGAAAACAGCGTGAACCCGG + Intergenic
1201790512 Y:17835337-17835359 TCATCAAAACAGCATAATACTGG - Intergenic
1201811042 Y:18070652-18070674 TCATCAAAACAGCATAATACTGG + Intergenic
1202267478 Y:23035556-23035578 CAAGCAAAACAGCATGATACTGG + Intergenic
1202352156 Y:24005057-24005079 TCATCAAAACAGCATAATACTGG - Intergenic
1202420470 Y:24669300-24669322 CAAGCAAAACAGCATGATACTGG + Intergenic
1202450316 Y:25000782-25000804 CAAGCAAAACAGCATGATACTGG - Intergenic
1202518623 Y:25665062-25665084 TCATCAAAACAGCATAATACTGG + Intergenic