ID: 1192089649

View in Genome Browser
Species Human (GRCh38)
Location X:68140494-68140516
Sequence GCTTCATGCTGACCTGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192089649_1192089654 3 Left 1192089649 X:68140494-68140516 CCACTTGCAGGTCAGCATGAAGC 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1192089654 X:68140520-68140542 CTGGTGAGGGTGATACAGAATGG 0: 1
1: 0
2: 1
3: 27
4: 271
1192089649_1192089657 15 Left 1192089649 X:68140494-68140516 CCACTTGCAGGTCAGCATGAAGC 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1192089657 X:68140532-68140554 ATACAGAATGGCTGGGCTCCTGG 0: 6
1: 28
2: 21
3: 22
4: 171
1192089649_1192089652 -10 Left 1192089649 X:68140494-68140516 CCACTTGCAGGTCAGCATGAAGC 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1192089652 X:68140507-68140529 AGCATGAAGCAACCTGGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 175
1192089649_1192089656 8 Left 1192089649 X:68140494-68140516 CCACTTGCAGGTCAGCATGAAGC 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1192089656 X:68140525-68140547 GAGGGTGATACAGAATGGCTGGG 0: 1
1: 0
2: 4
3: 18
4: 198
1192089649_1192089655 7 Left 1192089649 X:68140494-68140516 CCACTTGCAGGTCAGCATGAAGC 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1192089655 X:68140524-68140546 TGAGGGTGATACAGAATGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192089649 Original CRISPR GCTTCATGCTGACCTGCAAG TGG (reversed) Intronic
900676033 1:3886894-3886916 GCTTCCTCCTGAGCTGCAGGAGG - Intergenic
903035025 1:20487274-20487296 TCATCCTGCTGCCCTGCAAGGGG + Intergenic
907550478 1:55300807-55300829 GCCTCCTGGTGACCAGCAAGTGG - Intergenic
915493748 1:156266580-156266602 GCTGCAGGCTGAGCTGGAAGAGG - Exonic
920416413 1:205801626-205801648 TCTGAATGCTGGCCTGCAAGAGG + Intronic
920647033 1:207811486-207811508 GGTGCCTGCTGTCCTGCAAGGGG - Intergenic
1062955751 10:1539277-1539299 CCTTCATGCTCACTAGCAAGTGG - Intronic
1065195869 10:23264917-23264939 GCTGCATGCTGACCTGGTTGGGG - Intergenic
1065304124 10:24352654-24352676 GCTTCTTGATGACAGGCAAGTGG + Intronic
1067221444 10:44347032-44347054 GCTTCATGCTGACCTGGGAGGGG - Intergenic
1069598523 10:69688101-69688123 GCCTCAGGTGGACCTGCAAGAGG + Intronic
1072479719 10:95798927-95798949 GCTTCTTGCTCACATGCAGGTGG - Intronic
1073603521 10:104870508-104870530 CCCTCATGCTGAGGTGCAAGGGG - Intronic
1074943580 10:118258682-118258704 TCTTCATCCTGTACTGCAAGGGG + Intergenic
1075462931 10:122630788-122630810 GCTCCATGCAGAGCTGAAAGGGG - Intronic
1076543840 10:131230882-131230904 CCTTTGTGCTGGCCTGCAAGGGG - Intronic
1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG + Intronic
1083746753 11:64741365-64741387 GCTTCAGGCTGGCCTGGAGGAGG - Intronic
1089323710 11:117643407-117643429 CCTCCATGCTAACCTCCAAGGGG - Intronic
1090150206 11:124376175-124376197 GGATCAGGCTGACCCGCAAGTGG + Intergenic
1090334217 11:125951867-125951889 TCATCATGCTGAGCTGCGAGTGG + Intergenic
1091584843 12:1810287-1810309 GGTTCATTCTGATCTCCAAGAGG - Exonic
1092308832 12:7330746-7330768 CCTTCATGCTGAAGTCCAAGTGG + Intergenic
1093460354 12:19402310-19402332 GCTTCCTGCTGACCTGGCAAGGG - Intergenic
1094573623 12:31663688-31663710 GGATCAGGCTGACCTGCGAGTGG + Intronic
1097885362 12:64723581-64723603 CCTTCATTCTGACCATCAAGAGG - Intronic
1098283553 12:68885441-68885463 CCTTCATGCTGACCAGGAGGTGG + Intronic
1100935356 12:99658711-99658733 TCTTCATACAGCCCTGCAAGTGG - Intronic
1100995462 12:100295818-100295840 CATCCATGCTGAGCTGCAAGGGG + Intronic
1104843781 12:131836809-131836831 GCTTCATGGCAGCCTGCAAGTGG + Intronic
1106104425 13:26721801-26721823 GCTTTTTGCTGAACAGCAAGAGG - Intergenic
1106312537 13:28566484-28566506 GCTGCATGCTCACCTGCCTGTGG - Intergenic
1106850246 13:33782414-33782436 GCATCATGCTGCTCAGCAAGGGG - Intergenic
1107080047 13:36365049-36365071 GCATGATGCTGAACTGCTAGGGG + Intronic
1107885951 13:44874290-44874312 GTTTCATGCTGAACTGCAATTGG + Intergenic
1110355775 13:74565316-74565338 GTTTCCTACTGACGTGCAAGTGG + Intergenic
1111076805 13:83248144-83248166 TCTTCATGCTGAACTGCTTGGGG + Intergenic
1113593001 13:111513855-111513877 GGCTCATGGTGACCTGCAAGGGG + Intergenic
1116019323 14:39441656-39441678 TCTTCAGGATGACCTGCCAGTGG + Intergenic
1116387103 14:44345299-44345321 GGTTCATGATGACATGCAATAGG - Intergenic
1118148408 14:63164750-63164772 CATCCATGCTGAGCTGCAAGGGG - Intergenic
1122152772 14:99733629-99733651 GCTTCAGGGTGAGCTGCAGGAGG + Intergenic
1122952641 14:105054119-105054141 GCTTCCTGCTGACCTGGAGGTGG - Intronic
1131398965 15:92109623-92109645 GCTTCATGCTGACTGCCAAGTGG + Intronic
1132715647 16:1288767-1288789 ACCTCAGGCTGACCTGCCAGGGG + Intergenic
1133050762 16:3116007-3116029 GCTTCAGGCTTGGCTGCAAGTGG - Intronic
1136156736 16:28388078-28388100 GCTGAATGTTGTCCTGCAAGTGG + Exonic
1136206350 16:28727203-28727225 GCTGAATGTTGTCCTGCAAGTGG - Exonic
1141669133 16:85482345-85482367 GCTTCAAGCTGCCCTGCAAGGGG + Intergenic
1142418601 16:89956847-89956869 GCCACAGGCTGAGCTGCAAGGGG + Intronic
1144175744 17:12705360-12705382 GCTACCTACTCACCTGCAAGGGG + Intronic
1144328950 17:14207152-14207174 TGCTCATGCTCACCTGCAAGCGG + Exonic
1144799188 17:17913300-17913322 CATCCATGCTGAGCTGCAAGGGG + Intronic
1145925224 17:28641955-28641977 ACTCCATGCTGAACTGCATGAGG - Exonic
1153900512 18:9614238-9614260 GCTTCAGGAGGACCTGCAGGAGG - Exonic
1161638538 19:5405050-5405072 CCTTCTGGCTGACCTGCAATGGG + Intergenic
930901934 2:56517751-56517773 GCTTCATGTTCACCTTAAAGGGG - Intergenic
935624246 2:105156181-105156203 GCTTCTTGCTGTCCTCCATGTGG - Intergenic
940477022 2:154176181-154176203 GCATCATGCTGACTTCTAAGAGG - Intronic
943025450 2:182622663-182622685 GCTTCCTACTGACCTGGGAGTGG - Intergenic
944263332 2:197697475-197697497 CATCCATGCTGAGCTGCAAGGGG + Intronic
947467227 2:230361992-230362014 GCTTCATACTGACCTCCCACAGG - Intronic
1168884957 20:1242824-1242846 GATTCATGCTGAACTGAAAATGG + Exonic
1169488687 20:6053817-6053839 GTGTCATGCTTACCTGGAAGTGG + Exonic
1171109153 20:22464524-22464546 ACCACATGCTGACCTGCACGTGG + Intergenic
1172461590 20:35123093-35123115 GCTTGATTCTGAGCTGCAAATGG + Intronic
1175881913 20:62264267-62264289 GCCACATGCTGAGCTGCAGGAGG + Intronic
1177203774 21:17987512-17987534 GCTTCAAACTGAGCTTCAAGTGG - Intronic
1179126639 21:38596793-38596815 GTTTCAGGCTGAGCTGGAAGTGG + Intronic
1179616123 21:42584419-42584441 GCTTCATGGTGACCTGCGACTGG - Intergenic
1184783295 22:46659671-46659693 AGGTCATGCTGACCTGCAGGAGG - Intronic
1184935667 22:47718606-47718628 GCTTCCGGCTGTCCAGCAAGTGG - Intergenic
952776262 3:37049424-37049446 GTGTCAAGCTGACCTGTAAGAGG - Intronic
953543540 3:43843410-43843432 GCCTGTTGCTAACCTGCAAGGGG + Intergenic
953854908 3:46493795-46493817 CATCCATGCTGAGCTGCAAGGGG - Intergenic
954388508 3:50256939-50256961 GCTTCATGCTCTCATGCATGCGG - Exonic
954599583 3:51857861-51857883 CATCCATGCTGAGCTGCAAGGGG - Intergenic
955726506 3:61938999-61939021 GATTTATGCTGAACTGCAGGGGG - Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
963255426 3:143139996-143140018 GCTTCCTGCTGACCGGAATGTGG + Intergenic
963998860 3:151743503-151743525 TCTTCACACTGACCTGCCAGAGG + Intronic
964704919 3:159607906-159607928 GCTTCATGCTAAGCCACAAGTGG - Intronic
969875233 4:10131370-10131392 GCTGCAGGGTGACCTGGAAGAGG + Intergenic
971134514 4:23853776-23853798 ACTACATGCTGACTTGCATGTGG - Intronic
972250462 4:37294428-37294450 ACTACATGCTGACTTGCCAGAGG + Intronic
972585825 4:40436428-40436450 GCTTCATACTGACCTGTACCAGG + Exonic
973188341 4:47357507-47357529 GCTTCATGCTCAGCTGCAAGGGG - Intronic
981329956 4:143496960-143496982 GCATCATGCTGAAAAGCAAGTGG + Intergenic
984634245 4:182093607-182093629 GAATCATGCTTTCCTGCAAGTGG - Intergenic
986365399 5:7023445-7023467 GTTTCATGCTGACATGGAAAGGG - Intergenic
991997469 5:72402253-72402275 GGCTCATGCTCACCTGCAAAAGG + Intergenic
993729990 5:91410951-91410973 CCTTCATTCTGCCCTGCAAAAGG - Intergenic
995072279 5:107938176-107938198 GCTTTATGGTGACCTGAAATGGG + Intronic
996291055 5:121852383-121852405 GCTTCTTGATGTCCTGCAGGCGG - Exonic
998417731 5:141957845-141957867 GCATCATGCTTACCGCCAAGTGG + Exonic
999319425 5:150604183-150604205 GCTTCATGCTGTCCTGGCATGGG + Intronic
1000943521 5:167392398-167392420 GCATCATGCAGACCTGCACTGGG - Intronic
1004521615 6:16366251-16366273 GCATCTAGCTGACCTCCAAGAGG - Intronic
1005338220 6:24818498-24818520 GCTCCAAGCTGAGCTGCCAGGGG + Intronic
1006826347 6:36938939-36938961 CATCCATGCTGAGCTGCAAGGGG + Intergenic
1007462096 6:42026360-42026382 GCTCCATGATGACCTCCAAGGGG + Intronic
1008323287 6:50144912-50144934 GCTTAATGCAGAACTACAAGTGG + Intergenic
1009818708 6:68771800-68771822 TCTTCTGTCTGACCTGCAAGGGG + Intronic
1010246170 6:73661762-73661784 CATCCATGCTGAGCTGCAAGGGG + Intergenic
1013819622 6:114138903-114138925 GCTTCATCCTCACTTGGAAGGGG + Intronic
1016809993 6:148251495-148251517 TCTTCAGGTTGACCAGCAAGGGG - Intergenic
1016991647 6:149933850-149933872 GCTTCATGCCTTCCTGCAGGAGG + Intergenic
1017375288 6:153761254-153761276 CTTTCTTGCTGACCTGGAAGGGG + Intergenic
1017753043 6:157506422-157506444 GCCTCATGCTGACCTTGCAGAGG - Intronic
1018307968 6:162478176-162478198 GTTTCATACTGACCTGTAATTGG + Intronic
1019493515 7:1325763-1325785 GCCTCACACTGACCTGCATGGGG - Intergenic
1019625158 7:2012144-2012166 GCTCCAAGCTGCCCGGCAAGGGG + Intronic
1019774698 7:2905698-2905720 GCTTGCTCCTGACCTGCAGGAGG + Intergenic
1020179318 7:5909161-5909183 ACTTTATCCTGACCTGCAAAAGG - Intronic
1020303618 7:6815699-6815721 ACTTTATCCTGACCTGCAAAAGG + Intronic
1021921871 7:25493931-25493953 CCTTCATGCTGACCTGCTGGAGG + Intergenic
1023090851 7:36616067-36616089 GCCTCATCCTGACCTCCACGGGG + Intronic
1023480118 7:40625219-40625241 GCTCCATGCTGACCTAGACGTGG + Intronic
1026136481 7:67666512-67666534 GCTGCATGCTGACTTGTAAGTGG + Intergenic
1026973371 7:74481016-74481038 GATTCATGCTGCCTTCCAAGGGG - Intronic
1028506874 7:91580516-91580538 CCTTCATGCTTACCTGAAAGAGG - Intergenic
1029126872 7:98300758-98300780 GCTTCTGGCTGGCCTGCGAGGGG - Intronic
1029363251 7:100101728-100101750 TCTTCATTCTGTCCTCCAAGGGG + Exonic
1029602382 7:101575430-101575452 GCTTCATGGTGAAATGCATGGGG - Intergenic
1034876898 7:154732801-154732823 GATTCCTGCTGACATGCACGGGG - Intronic
1039973667 8:42341674-42341696 GCTTTATGCTGAACTGCAGTGGG + Intronic
1041143908 8:54851171-54851193 GCTTCCTGCTAACCTGCACATGG - Intergenic
1042700046 8:71602151-71602173 GCTCCAGGCTGGCATGCAAGAGG + Intergenic
1043308780 8:78831992-78832014 GGCTCATACTGGCCTGCAAGAGG + Intergenic
1044947257 8:97400960-97400982 GCTTGCTGCTGACCTGAAAGGGG + Intergenic
1053444553 9:38141799-38141821 GATTCATGGTGGCTTGCAAGTGG + Intergenic
1054421763 9:64941635-64941657 TCTTCTTGTTGATCTGCAAGTGG + Intergenic
1055766992 9:79674029-79674051 GCTTCAGGCTTCCCTCCAAGTGG + Intronic
1059636783 9:116179330-116179352 GCTCCATGCCGTCCTGCAAAAGG + Intronic
1059834045 9:118129806-118129828 CTTTCCTGCTGACCTGGAAGGGG + Intergenic
1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG + Intronic
1190520913 X:51279185-51279207 CATCCATGCTGAGCTGCAAGGGG - Intergenic
1191937622 X:66442032-66442054 GCTTTATTCTGACCTGTGAGGGG + Intergenic
1192089649 X:68140494-68140516 GCTTCATGCTGACCTGCAAGTGG - Intronic
1194692006 X:96998653-96998675 TCTTTATGCTGATCTGCAGGAGG + Intronic
1195674460 X:107497294-107497316 GCTTCTTCCTGACCTTCAGGTGG + Intergenic
1198314038 X:135449235-135449257 TGTTCATCCTGCCCTGCAAGAGG - Intergenic
1199600261 X:149537501-149537523 GTTTCGTGCTGACCTGCTATTGG + Intergenic
1199650322 X:149942439-149942461 GTTTCGTGCTGACCTGCTATTGG - Intergenic
1201463224 Y:14251412-14251434 ACTTCATGCTGAGATGGAAGTGG + Intergenic