ID: 1192093928

View in Genome Browser
Species Human (GRCh38)
Location X:68190143-68190165
Sequence GTCCTCTGGCGTGTCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192093928_1192093932 5 Left 1192093928 X:68190143-68190165 CCCAGTGAGACACGCCAGAGGAC 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1192093932 X:68190171-68190193 ATGAAATAAACTTAGAAGGAAGG 0: 1
1: 0
2: 2
3: 48
4: 524
1192093928_1192093931 1 Left 1192093928 X:68190143-68190165 CCCAGTGAGACACGCCAGAGGAC 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1192093931 X:68190167-68190189 TCACATGAAATAAACTTAGAAGG 0: 1
1: 0
2: 3
3: 29
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192093928 Original CRISPR GTCCTCTGGCGTGTCTCACT GGG (reversed) Intronic
901285815 1:8077862-8077884 GACCTCTGGCCTCTCTCCCTGGG + Intergenic
902890328 1:19438697-19438719 GTCCTCTGCTGAGTCTCACTGGG - Intronic
904576033 1:31505584-31505606 GTCCTCAGGCGTCACTCACCTGG - Intergenic
913550110 1:119908926-119908948 CTCCCCTGGCTTGTCTCACTTGG + Intergenic
917730426 1:177870002-177870024 CTCCTCTGGCATGTCTTGCTGGG - Intergenic
922127221 1:222739650-222739672 GTTCTCTTGCGTGTCTTACAGGG - Intronic
923963314 1:239107345-239107367 GTCACCTGGCATGTTTCACTTGG + Intergenic
1064296446 10:14083392-14083414 GTCCTCTGCGGTGTCACAATTGG - Intronic
1065236577 10:23658519-23658541 ATCCTCTGGTATGTCTCACCAGG - Intergenic
1070911393 10:80121868-80121890 TTCCGCTGCCGTGTCTCAGTAGG - Intergenic
1074601123 10:114914230-114914252 GTCCTCAGGCGTATCTATCTAGG + Intergenic
1077195220 11:1276459-1276481 GGCCTCTGGCCTGGCTCACCTGG - Exonic
1077578477 11:3402228-3402250 GTCCCCTGGGGTGTCTCACGGGG + Intergenic
1078783579 11:14463903-14463925 GTCCTCTGCCATCTCTCACTTGG + Intronic
1084235514 11:67785744-67785766 GTCCCCTGGGGTGTCTCACGTGG + Intergenic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1094359246 12:29612215-29612237 GTCCTCAGCAGTGTCTCATTTGG - Intronic
1102691226 12:114762649-114762671 CTCCTCTAGCGTGTGTCTCTGGG + Intergenic
1103801895 12:123543503-123543525 GTCCACTGGAGAGTCTCATTAGG + Intergenic
1104881239 12:132071998-132072020 GTGTTCTGGGGTGACTCACTGGG + Intronic
1114042023 14:18687854-18687876 TTCCACTGCCGTGTCTCAGTGGG - Intergenic
1114526624 14:23370613-23370635 GTCCTTTGGGGTGTCCCTCTAGG - Intergenic
1119558669 14:75572543-75572565 GTCTTCAGGCTTGGCTCACTGGG + Intergenic
1121837199 14:97102622-97102644 TTCCTCTGGGGTCTCTCTCTAGG + Intergenic
1122784291 14:104156747-104156769 GGCCTCTGGCCTGTGCCACTTGG + Intronic
1122811246 14:104290414-104290436 GTCCTCTGGAGTGGCACATTCGG + Intergenic
1126755178 15:51918811-51918833 GTCCTCTGGCCTGCCTAGCTGGG - Intronic
1133347081 16:5078378-5078400 GTCCCCTGGGGTGTCTCATGGGG + Intronic
1136525024 16:30823968-30823990 GTCCCCTGGCGTGTGTCATCAGG + Intergenic
1138515802 16:57535111-57535133 GTCCTCTGTGGTTTCCCACTGGG - Intronic
1140974740 16:80048426-80048448 ATCCTCTGGGATGTCTCTCTGGG - Intergenic
1143173287 17:4942555-4942577 GTCCTCTGCCTTGTCTCCCTAGG + Exonic
1143648471 17:8247913-8247935 TTCCTCTGCCTTGTCTCTCTGGG - Intronic
1148339268 17:46863721-46863743 GTCCTCTGCCATGTCTAACTCGG - Intronic
1150650230 17:67005354-67005376 GTCCTCAGGGGTGTACCACTGGG - Intronic
1151265845 17:72954406-72954428 TTCCACTGGCGTGTAACACTTGG - Intronic
1151801253 17:76381274-76381296 GTTCTCAGGTGTGTCTCCCTGGG + Intronic
1153291726 18:3508443-3508465 GTCCATTGGAGTCTCTCACTTGG - Intronic
1157478479 18:48037968-48037990 GTGCTCTGGCTTATCTCCCTCGG + Intronic
1159544346 18:69820398-69820420 GTCCACTGGTGTGTATTACTAGG - Intronic
1160037717 18:75317000-75317022 GTCCTCTGGCGTGGCTTTCAAGG - Intergenic
1160050396 18:75428052-75428074 CTCCTGTGGAGTGTCTCATTAGG - Intergenic
1166230283 19:41422478-41422500 GTCCTGTGGCGTCTGGCACTTGG + Intronic
1166325182 19:42045454-42045476 GTTCTTTGGCTGGTCTCACTTGG - Intronic
1168592270 19:57647182-57647204 GCCCCCTGGTGTATCTCACTTGG + Intergenic
925529387 2:4842632-4842654 GGGCTCTGGTGTGTTTCACTTGG - Intergenic
932310599 2:70736574-70736596 GTCCTGTGTCATGTCTTACTTGG - Intronic
938268194 2:129944678-129944700 TTCCGCTGCCGTGTCTCAGTGGG + Intergenic
938463793 2:131514028-131514050 GATCTCTGGGGTGTGTCACTTGG + Intergenic
947795195 2:232890113-232890135 GGTCTCTGTCCTGTCTCACTGGG + Intronic
1169459391 20:5781201-5781223 GTCTTCTGCCATATCTCACTAGG - Intronic
1170756311 20:19210270-19210292 CTCCTGAGGCCTGTCTCACTTGG + Intergenic
1174945455 20:54980319-54980341 GTCCTGTGGCTTGTCTTCCTTGG + Intergenic
1175943329 20:62547800-62547822 GTGCTCTGCCCTGTCTCACACGG - Intergenic
1176235805 20:64052953-64052975 GGCCTCTGCCATGTCTCACTAGG - Intronic
1180981980 22:19882870-19882892 ATCCTCTGGCTTGCCTCTCTGGG - Intronic
1183057386 22:35315298-35315320 ATCCTCTGGCCTGTGTGACTGGG + Intronic
1183734668 22:39637154-39637176 GCCCTCTGTACTGTCTCACTGGG + Intronic
1184091694 22:42296314-42296336 ATCCTCAGGCCTGTCTCACAGGG - Intronic
950095912 3:10330354-10330376 GTCCTCTGTCCTGCCTCACAGGG + Intronic
950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG + Intronic
957051486 3:75415541-75415563 GTCCCCTGGGGTGTCTCACGGGG + Intergenic
960155959 3:114297515-114297537 GTCCTCTGGCATATGACACTGGG - Intronic
961302995 3:125934054-125934076 GTCCCCTGGGGTGTCTCACGGGG - Intronic
961885076 3:130091721-130091743 GTCCCCTGGGGTGTCTCATGGGG + Intronic
967136976 3:186520854-186520876 TTCCTCTGGGGTGTGTCTCTAGG - Intergenic
968994268 4:3935920-3935942 GTCCCCTGGGGTGTCTCATGGGG + Intergenic
969459505 4:7321605-7321627 GTTCTCTGGCCTGTCTCCTTTGG - Intronic
969819669 4:9710316-9710338 GTCCCCTGGGGTGTCTCATGGGG - Intergenic
973793226 4:54397122-54397144 GGCCTCTGGCTTGTGTTACTTGG + Intergenic
980830433 4:138124735-138124757 GTCATCTGGAATGTCTGACTGGG + Intergenic
984066045 4:175049059-175049081 TTCATCTGGGGTGTTTCACTTGG + Intergenic
985913801 5:2902780-2902802 GTCCTCTGGTCTATGTCACTGGG + Intergenic
988904276 5:35770181-35770203 GTCTTCAGGCTTGTGTCACTGGG - Intronic
992850239 5:80799731-80799753 ATCCTCTGACATGTCTCAATGGG - Intronic
994213715 5:97113641-97113663 GTTCTCTGGTCTGTCTGACTTGG + Intronic
994352893 5:98767692-98767714 ATCCTCTGGGCTGGCTCACTGGG + Intergenic
997573680 5:134955718-134955740 GTCCTCTTGGGTCTCTTACTGGG + Intronic
998622132 5:143806637-143806659 GTGCTCTGGCCTGCCTCCCTTGG + Intergenic
998847643 5:146326434-146326456 GCACTCTGATGTGTCTCACTGGG + Intronic
1001090994 5:168740881-168740903 GTCCTTTGACATGTGTCACTTGG + Intronic
1002492117 5:179586038-179586060 ATCCGCTGCAGTGTCTCACTGGG - Intronic
1002538478 5:179891282-179891304 CTGCTCTGCCCTGTCTCACTGGG - Intronic
1002906857 6:1456224-1456246 GTCCTGTGGCATTTCCCACTTGG + Intergenic
1003899799 6:10643967-10643989 CTCCTCTTGGGTGTCTCACTGGG + Intergenic
1006402583 6:33826410-33826432 GTCCTCTGGGGTGTCCACCTGGG + Intergenic
1008021785 6:46586907-46586929 GTCCTGTGCAGTGTCTCTCTGGG - Intronic
1016821551 6:148350981-148351003 GTTCTCTGAAGTGTTTCACTGGG + Intronic
1017978259 6:159376292-159376314 CTTCTGTGGCGTGTGTCACTTGG + Intergenic
1019266208 7:118816-118838 GTCCTTTGGCGTGGCTGTCTTGG + Intergenic
1020318551 7:6924286-6924308 GTCCCCTGGGGTGTCTCACGGGG + Intergenic
1021576332 7:22109151-22109173 GACCTCTGGCGTGGTTGACTCGG + Intergenic
1022816429 7:33918781-33918803 GACCTCTGGTGGGTCCCACTGGG - Intronic
1029844072 7:103395087-103395109 GTTCTTTGGCAGGTCTCACTTGG - Intronic
1033008980 7:137598735-137598757 GACCTCTGAAGTGTCTCTCTAGG + Intronic
1036381871 8:8240907-8240929 GTCCCCTGGGGTGTCTCATGGGG - Intergenic
1040574916 8:48643578-48643600 GCCCTCTGGCTTATCTCCCTGGG + Intergenic
1049556855 8:143286839-143286861 GGCCACTGGTGTGTCTCACCTGG + Intergenic
1049706842 8:144047071-144047093 CTCCTCTGGGGTGGCTCACCGGG + Exonic
1050312311 9:4366113-4366135 ATCCTCTGTCCTATCTCACTGGG - Intergenic
1052821294 9:33139645-33139667 GCTCTCTGGAGTTTCTCACTGGG - Intronic
1053542332 9:38987115-38987137 GATCTCTGGGGTGTCCCACTTGG - Intergenic
1053806784 9:41810633-41810655 GATCTCTGGGGTGTCCCACTTGG - Intergenic
1054623809 9:67376794-67376816 GATCTCTGGGGTGTCCCACTTGG + Intergenic
1057037913 9:91825002-91825024 GCCCTGTGGCCTGTCTGACTTGG - Intronic
1061383555 9:130275216-130275238 GTCTTCTGGAGTTTCTCCCTGGG + Intergenic
1061912363 9:133731985-133732007 GTCCTCAGGCGTGGACCACTGGG + Intronic
1062012431 9:134274291-134274313 GGCCTCCTGCTTGTCTCACTGGG + Intergenic
1062441182 9:136570568-136570590 GTCCTCTGGCCTCCCTCACCAGG + Intergenic
1189453988 X:41167173-41167195 TTCTTCTTGAGTGTCTCACTTGG + Intronic
1192093928 X:68190143-68190165 GTCCTCTGGCGTGTCTCACTGGG - Intronic
1200151675 X:153954311-153954333 GTGGTCTGGTGTGTCTCACAGGG + Exonic