ID: 1192097084

View in Genome Browser
Species Human (GRCh38)
Location X:68223534-68223556
Sequence TTGGAGACTCAGAAAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 4, 2: 40, 3: 166, 4: 601}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192097084 Original CRISPR TTGGAGACTCAGAAAAAGGG TGG Intronic
902458628 1:16554394-16554416 TTGGAGCCTCTGAAAAGGAGGGG + Intergenic
902493529 1:16853522-16853544 TTGGAGCCTCTGAAAAGGAGGGG - Intronic
903151813 1:21415154-21415176 TTGGAGCCTCTGAAAAGGAGGGG + Intergenic
903680631 1:25094186-25094208 ATGGAGACCCTCAAAAAGGGAGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904280355 1:29414370-29414392 TTGGGGACTCAGTCAGAGGGAGG + Intergenic
904940878 1:34164444-34164466 TTGCAGACGCAGAAATGGGGAGG + Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906757031 1:48327800-48327822 TTGGAGACTCCAAAAATGGTGGG + Intronic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907280290 1:53342821-53342843 ATGGAGTTTCAGAGAAAGGGAGG + Intergenic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
908011970 1:59787198-59787220 TGGAAGACTCAGAAAAAGAGAGG - Intergenic
908595038 1:65678937-65678959 TTGGAGACTCAGAATAGGAGAGG - Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
911382646 1:97135060-97135082 AGGGAAACTCAGAAAAATGGTGG - Intronic
912388876 1:109287846-109287868 TTGGGGACTCAGGGAAAGGGTGG - Intergenic
912574166 1:110649600-110649622 GTGTTGACTCAGAAAAAGTGAGG + Intergenic
913057288 1:115174352-115174374 CTGGAAACTCACAAAAAGGAGGG + Intergenic
913607023 1:120475972-120475994 TTGGAGCCTCTGAAAAGGAGGGG - Intergenic
913988320 1:143585635-143585657 TTGGAGCCTCTGAAAAGGAGGGG + Intergenic
914209412 1:145564172-145564194 TTGGAGCCTCTGAAAAGGAGGGG + Intergenic
914268332 1:146056540-146056562 TTGGAGCCTCTGAAAAGGAGGGG + Intergenic
914368763 1:147004321-147004343 TTGGAGCCTCTGAAAAGGAGGGG - Intergenic
914584171 1:149045866-149045888 TTGGAGCCTCTGAAAAGGAGGGG + Intronic
914855280 1:151346216-151346238 TCGGAGCCTCTGAAGAAGGGTGG + Exonic
915496175 1:156284283-156284305 TTTGAGACACAGGTAAAGGGAGG + Exonic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915964601 1:160295294-160295316 TAGGAGACCCAGAAAACAGGAGG + Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916274062 1:162974802-162974824 TTTGAGCCTCAGCAAAATGGAGG + Intergenic
916281112 1:163052628-163052650 TTGGAAACTGAGAGAAAAGGAGG - Intergenic
916415389 1:164587883-164587905 CAGGAGATTCAGAAAAGGGGTGG - Intronic
916451557 1:164925862-164925884 TTGGAGTGTCAGAAAACTGGGGG + Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917660182 1:177170657-177170679 TTGGACACTCTTAAAAAGGCTGG - Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920156173 1:203953632-203953654 TTGGAGTCCCAGAAAAAGTGAGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922371512 1:224915528-224915550 TTGGACATTCAAAAAAATGGAGG + Intronic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923050913 1:230390767-230390789 ATGGAGTCTCAAAAAAAGGCTGG + Intronic
923067409 1:230531513-230531535 TTGGAGACTCAAAGGAAGGGTGG + Intergenic
923085346 1:230698952-230698974 CTGGAGACTCTAAAAAGGGGAGG - Intergenic
923427945 1:233890822-233890844 TTGGATACTCAGAAGAAGACAGG + Intergenic
923722490 1:236479003-236479025 TTGGGGACTCAGGGAAAAGGTGG + Intronic
924036666 1:239944798-239944820 TTGGAGGCTCAGAAGAAGACAGG - Intergenic
924935898 1:248769999-248770021 TTGGGGACTCAGGGAAAGGGTGG + Intergenic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063767525 10:9159834-9159856 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063850270 10:10181596-10181618 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064071126 10:12229020-12229042 TTGGTGACTCACTGAAAGGGAGG - Intronic
1064151049 10:12865351-12865373 TTTGAGTCTCAGAGAAATGGAGG - Intergenic
1064282867 10:13967369-13967391 TTGGGGACTCGGGGAAAGGGTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065284574 10:24175194-24175216 TTGAAGACTCGGGAAAAGGATGG - Intronic
1065306543 10:24374496-24374518 TTAAAGACTCAGAGAAATGGTGG - Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065943093 10:30582699-30582721 TTGGAGACTTAGAGGAAGGGGGG + Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066297322 10:34066198-34066220 TTAGAGACACAGACCAAGGGAGG + Intergenic
1066377929 10:34875294-34875316 GTGGAGTATCAGAACAAGGGCGG + Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067035295 10:42911306-42911328 TTGGAGATCAAGGAAAAGGGTGG + Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1068145648 10:53067141-53067163 TTGGGGACTCTGGGAAAGGGTGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068754697 10:60638921-60638943 TTGTAGTCTCAAAGAAAGGGGGG + Intronic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069218337 10:65851346-65851368 TTGGGGACTCAGGAAAGGGTGGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069493486 10:68881930-68881952 TTGGAGATTTAAAAAAAAGGGGG - Intronic
1070004684 10:72411891-72411913 TTGGTGATTCAGAAAAACAGTGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1071822354 10:89291363-89291385 CTGGAGACTGGGAAATAGGGTGG - Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075613082 10:123869036-123869058 TAGGTGACTAAGAAAAACGGAGG + Intronic
1076664997 10:132082383-132082405 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1077276434 11:1712693-1712715 TCAGAGACTCAGAAGAGGGGCGG - Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077909076 11:6558562-6558584 AAGGAGCCTCAGGAAAAGGGTGG - Exonic
1078687331 11:13545735-13545757 TTGGAGGTTCAGAAAAAGACAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079724237 11:23860536-23860558 TAGAAGACTCAAAACAAGGGCGG - Intergenic
1079862607 11:25692842-25692864 TTGGGGACTGAGGGAAAGGGTGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081461514 11:43276617-43276639 TTGGGGACTCAGGGGAAGGGAGG - Intergenic
1081514772 11:43816771-43816793 TCGGGGACTCAGGAAAAGGGTGG - Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1082771032 11:57207518-57207540 TTGGGGACAGAGGAAAAGGGGGG - Intergenic
1085532570 11:77200738-77200760 TTGAAGAGCCAGAAGAAGGGAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087363607 11:97192108-97192130 TTGTAGACTCTGAAAAGGGTGGG - Intergenic
1087557363 11:99738270-99738292 TTGGATACTCAGACACAGTGAGG + Intronic
1087694549 11:101361698-101361720 TTGGATACAAAAAAAAAGGGGGG + Intergenic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1087865725 11:103224406-103224428 TTGGAGACTCGGGAAAGGGCAGG - Intronic
1088059020 11:105622842-105622864 TTGTAGACTCTGAATAATGGGGG - Intronic
1088276208 11:108088980-108089002 TTGGACTCTCACAAAAAGGAAGG - Intronic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1090320983 11:125843378-125843400 TTGGAGATTCCGAAGAGGGGAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091797787 12:3307087-3307109 TGGGAGGCTCAGGTAAAGGGTGG + Intergenic
1092024750 12:5231325-5231347 TGGGAGAGGCAGAAACAGGGTGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092330090 12:7578764-7578786 TTGGAGACACAGAACAGGGTAGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094303166 12:28988982-28989004 TTGGCAAATCAGAAAAAGGGGGG - Intergenic
1094471459 12:30805276-30805298 GTGGAGGCTCAGAAAAAGACAGG - Intergenic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096427443 12:51516153-51516175 TTGGAGACTTAGAGAAGAGGGGG + Intergenic
1096629719 12:52918345-52918367 TTGGAGCCTCAGAAACATGCAGG + Intronic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1097180326 12:57168127-57168149 TGCGAGACACAGAAAAAGTGAGG - Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097924736 12:65114866-65114888 GTGGAGATTCAGAAAAATGAAGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098442027 12:70529068-70529090 ATGAAGACTGAGAGAAAGGGTGG + Intronic
1098610631 12:72453096-72453118 TTGGAGGCTCAGAAGAAGACAGG + Intronic
1099014749 12:77330992-77331014 TTGGAGACTTGGGGAAAGGGTGG + Intergenic
1099749615 12:86756211-86756233 TTGAACACACAGAAAAAAGGTGG - Intronic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101303033 12:103501273-103501295 TGGGAGTGTCAAAAAAAGGGGGG + Intergenic
1101379481 12:104202108-104202130 TTGGAGACTTGGAGAAAGGGTGG - Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101807218 12:108074893-108074915 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102984359 12:117266263-117266285 TTGGGGACTCGGGGAAAGGGTGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105681231 13:22729276-22729298 TTGGAGACTGGGGGAAAGGGTGG + Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106551163 13:30772332-30772354 TTTCAGCCTCAGAAAAAGGCTGG + Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1106989913 13:35406460-35406482 TTGGGGACTCAAAGAAAGGGTGG - Intronic
1107805216 13:44147283-44147305 TGGGAGAGTCAGAAAAGAGGAGG - Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108851120 13:54730582-54730604 TTGGAGACTAAGAAAAGCTGGGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111433608 13:88177926-88177948 TTGGAGACTGTGTAAAAGAGAGG + Intergenic
1112626534 13:101111078-101111100 TCAGAGACTCTAAAAAAGGGGGG - Intronic
1112909156 13:104460727-104460749 TTGGTGACTCAGAAAATGCTTGG + Intergenic
1113862672 13:113499590-113499612 TTGAGGACTCACAAAAAGGTTGG + Intronic
1113990299 14:16023158-16023180 CTGGAGTGTCAGCAAAAGGGAGG + Intergenic
1114215769 14:20656683-20656705 GTGAAGGCTCAGAAAAAGTGAGG + Intergenic
1115030009 14:28784053-28784075 TTGGAGAATAGGGAAAAGGGAGG + Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115442941 14:33456941-33456963 TTGGCGACTGAGAACAAGGCAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115778785 14:36746435-36746457 TTGGAGACTCCAAAACTGGGAGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116545146 14:46156121-46156143 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117958070 14:61137956-61137978 GTAGAGACACAGAGAAAGGGTGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1119749625 14:77068163-77068185 TTGGAGAATCTGGAGAAGGGTGG - Intergenic
1119966751 14:78924854-78924876 ATTGAGTCTCAGAAATAGGGGGG + Intronic
1121438600 14:93934784-93934806 TTGGAGGTTCTGAAAAAAGGAGG + Exonic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121886610 14:97548794-97548816 CTGGAGATTCAGAGAAAGGCAGG + Intergenic
1122031573 14:98916143-98916165 TGGGGGACTCAGCACAAGGGAGG - Intergenic
1122725429 14:103747666-103747688 TTGGGGACTCGGGGAAAGGGTGG - Intronic
1123806680 15:23881016-23881038 GTGGACACTGAGAAAAAGGCTGG - Intergenic
1124234124 15:27971977-27971999 TTGGAGACTAGGAAGAGGGGAGG - Intronic
1125235827 15:37512380-37512402 ATGGAGGCTGAGAAAAGGGGAGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1126138531 15:45416393-45416415 GAAGAGACTCAGAAAGAGGGAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127065700 15:55235672-55235694 TAGGAGACTTTGAAAAAGGAGGG - Intronic
1127097948 15:55532830-55532852 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127721966 15:61711704-61711726 TTGAGGACTCAGGGAAAGGGTGG + Intergenic
1127767425 15:62200508-62200530 TTGGAGACTCCAAAAGTGGGAGG + Intergenic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130300706 15:82678180-82678202 TTGGAGAGGCAGAAAATGGGTGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130700263 15:86172026-86172048 TTGGAGACTTGGGGAAAGGGTGG + Intronic
1130780050 15:87026972-87026994 TTGGGGACTCAGGGAAAGGGTGG + Intronic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131897791 15:97052831-97052853 TAGGAAACTGAGAAAAAGAGAGG + Intergenic
1131960266 15:97782938-97782960 TTACAGACTCAGAAAAAGAGAGG - Intergenic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1138405274 16:56788028-56788050 TTGGAGACGCAAGAAAAGAGAGG - Intronic
1138833310 16:60402658-60402680 TTGGGGACTCTGGGAAAGGGTGG + Intergenic
1138855972 16:60692204-60692226 ATGGAAGCTCAGAAAAAGTGTGG + Intergenic
1139153341 16:64411271-64411293 TTAGAGATTCAGAATCAGGGAGG - Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139620848 16:68140951-68140973 TTGTAGACTCAGAAGAGGGTAGG - Intronic
1140532804 16:75681713-75681735 TTGGGGACTCAGGGGAAGGGTGG - Intronic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1142909987 17:3080730-3080752 TAGAAGACTCAGAAGAAGAGAGG - Intergenic
1143308366 17:5967878-5967900 TTGGGGACTCGGGGAAAGGGTGG - Intronic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1143789939 17:9286801-9286823 CCAGAGACTCAGAAAAAGGGTGG + Intronic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146757375 17:35445050-35445072 ATGGAGACTCAGGAAAAGATAGG + Exonic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1146915354 17:36674905-36674927 CTGGGGACTCAGGGAAAGGGCGG + Intergenic
1147696896 17:42362006-42362028 AAGGTGACTCAGAGAAAGGGAGG + Intronic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148195475 17:45709817-45709839 CCGGAGACGCAGAGAAAGGGAGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149422101 17:56521085-56521107 TTAGAGGCAAAGAAAAAGGGTGG - Intergenic
1150951671 17:69808994-69809016 TTGAAGACACAGCAAAAAGGCGG + Intergenic
1153065955 18:1045463-1045485 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
1153256581 18:3177907-3177929 TGGAACAGTCAGAAAAAGGGAGG - Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153815924 18:8790137-8790159 TTGAAGAGTCACAGAAAGGGAGG - Intronic
1155334698 18:24751904-24751926 TTGGAGTCTCTGGCAAAGGGAGG - Intergenic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156114981 18:33776632-33776654 TTGTAGCCTCTGAAAAAGGAAGG - Intergenic
1156178855 18:34579919-34579941 TTGGAGCCTCAGAAAAGTAGCGG - Intronic
1156368348 18:36450075-36450097 TTGGGGACTCAGGGAAAGGGTGG - Intronic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159029795 18:63219146-63219168 TTGGAGAATCAGAAAAAGCCTGG - Intronic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159950258 18:74477986-74478008 TTGGAGACACAGAACTATGGGGG - Intergenic
1160007894 18:75081674-75081696 TTGTACACTCAGAAACAGGTGGG - Intergenic
1160671260 19:364816-364838 TTGGAGACTAGGAAGAAAGGTGG + Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161847227 19:6718843-6718865 GTGGAGTCTCAGAGAAGGGGAGG + Intronic
1162682122 19:12353235-12353257 TTGTAGACAGAGAATAAGGGTGG - Intronic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1163171247 19:15532746-15532768 TTGGAGTCTCAGAACCAGGCAGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163688507 19:18725662-18725684 TGGGAGGCTCAGGAAGAGGGAGG - Intronic
1164489523 19:28693736-28693758 TTGGAGGCTCAGAATAGGCGAGG - Intergenic
1164567059 19:29333564-29333586 TTGCTGACACATAAAAAGGGGGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1165015082 19:32874926-32874948 TTGGAGAGAAAGAAGAAGGGCGG - Intergenic
1165617425 19:37214251-37214273 TTAGAGAGACAGACAAAGGGAGG - Intronic
1165969179 19:39611259-39611281 TTGGAGACTCGAAGGAAGGGTGG - Intergenic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168520747 19:57048697-57048719 TTGGGGACGCAGAGAAAGGTCGG + Intergenic
925880763 2:8350421-8350443 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
926606542 2:14904022-14904044 CTGGACACTCAGAGAAACGGGGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927722579 2:25395215-25395237 TTGGGGACTCGGGGAAAGGGTGG + Intronic
928205949 2:29283510-29283532 GAGAAGACCCAGAAAAAGGGTGG + Intronic
928223142 2:29421954-29421976 TTGGAGGTTAAGAAAAAGAGAGG - Intronic
929271938 2:39982223-39982245 CTGAAGACTCAGAGAAAGGCTGG + Intergenic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
929655878 2:43731117-43731139 TTGGGGACTGAGGGAAAGGGTGG + Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930554114 2:52873407-52873429 TTGAAGACTCAGAAGAAGAGAGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
933574642 2:84053757-84053779 TTGGAGCCAGAGAAAAATGGGGG + Intergenic
933700719 2:85253656-85253678 TTGGAGCCTCAAAGAAAGAGGGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933937724 2:87219826-87219848 TTGGAGACTCATTAGAAGGCAGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
936355415 2:111745947-111745969 TTGGAGACTCATTAGAAGGCAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936682857 2:114794395-114794417 TTAGAGATTCAGAGAAAGCGAGG + Intronic
936884768 2:117297198-117297220 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
937699076 2:124843058-124843080 TTGGGGACTCAGGAAAGGGTGGG - Intronic
937735228 2:125279797-125279819 TTGGAGAATCTGAAATTGGGAGG + Intergenic
937773795 2:125752089-125752111 GTGGAGACCCAGATCAAGGGAGG - Intergenic
937972101 2:127558877-127558899 TTGGGGACTCGGGGAAAGGGAGG + Intronic
938809605 2:134840917-134840939 TTGGGGACTCGGGGAAAGGGTGG - Intronic
938861070 2:135370332-135370354 TTGGGGACTCGGGGAAAGGGTGG - Intronic
938947860 2:136229863-136229885 TTGGGGACTCAGGGAAATGGTGG + Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939182804 2:138823828-138823850 TTGGAGACAAAGAATAGGGGTGG + Intergenic
939881225 2:147633624-147633646 TTGGAGGCTGAGTAAAAGAGAGG - Intergenic
940690776 2:156917832-156917854 TTGAAGTCTCAGAAATGGGGAGG - Intergenic
940713693 2:157193209-157193231 TGAGAGACTCAGCAAAAGGCTGG + Intergenic
941358452 2:164521351-164521373 TTGGGGACTCAGGGAAAAGGTGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941702611 2:168620259-168620281 TTGGGGACTCAGGGAAAGGATGG + Intronic
942054179 2:172167287-172167309 TTGAGGACTCAGAAAAAGACAGG + Intergenic
942062387 2:172239749-172239771 TTGAGGAGTCAGAAAAAGGAAGG + Intergenic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
944521551 2:200574692-200574714 GTAGAGAGTCAGAAAAAGGGAGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946759091 2:222975361-222975383 TTGTTGACTTAAAAAAAGGGGGG - Intergenic
946782249 2:223203980-223204002 TTGGAGACTCCAAAAAAATGTGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947197395 2:227582631-227582653 TAGCAGGCTCAGAAAAAGGCAGG + Intergenic
948418457 2:237835865-237835887 TTGGGGACTGAGGGAAAGGGTGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170313619 20:15018445-15018467 TTGGAGGCTCAGAAGAAGATGGG - Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171813528 20:29763747-29763769 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172322358 20:34005737-34005759 TTGGAAACTGAGACAAAGGGAGG + Intronic
1172986408 20:38994815-38994837 TTTTAGATTCAGAAAAAGCGAGG + Exonic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173039965 20:39452866-39452888 TGTGAGCCTCAGAAAAAGTGGGG + Intergenic
1173415098 20:42847988-42848010 TTGGGGACTCGGGGAAAGGGTGG - Intronic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174857076 20:54056439-54056461 TTGGAGACTCCAAAGAAGGGAGG + Intronic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175700370 20:61132501-61132523 TTGGGGACTCAGGGAAAGGGAGG - Intergenic
1178936064 21:36862814-36862836 CTGGAGACTCACCAAAAGGAAGG + Intronic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1179112543 21:38460000-38460022 CTAGAGACTCAGGAAAAGAGAGG + Intronic
1179139472 21:38711852-38711874 TTGGAGAGTGAGAAAAGGTGTGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180316973 22:11284368-11284390 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1180413637 22:12639159-12639181 TCGGGGACTCAGAGAAAGGCTGG - Intergenic
1183087110 22:35493156-35493178 ACTGAGACTCAGAAAAGGGGAGG + Intergenic
1183240550 22:36654916-36654938 TTGCAGAGTCAGGAAAAGTGTGG + Intronic
1183686063 22:39362153-39362175 TTGGAGCCTCAAGAAAAAGGGGG - Intronic
1185111707 22:48903764-48903786 TTGGAGAATCAGAAAAGGCGTGG - Intergenic
949131154 3:502793-502815 CTGGAGAGTCAGAAAATGTGTGG + Intergenic
949469678 3:4381323-4381345 TTGGGGACTCGGGGAAAGGGTGG + Intronic
949769275 3:7561029-7561051 TTGGAGACTAAGACACAGGCAGG - Intronic
950697910 3:14718139-14718161 TTGGAGTCTCAGAAGAAAAGGGG - Intronic
951261871 3:20519437-20519459 TTGGGAACTCAGGGAAAGGGTGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951465902 3:23000239-23000261 TTGGAGTATGAGAAAAATGGAGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953177036 3:40562185-40562207 GTAGAGACACAGAGAAAGGGTGG - Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954760381 3:52869540-52869562 TTGGGGACCCAGGAGAAGGGAGG - Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956377372 3:68629237-68629259 TTGGAGATTCAGAGGATGGGAGG - Intergenic
956658330 3:71574871-71574893 TTGGAGACTTAGAGAAACAGAGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
958470434 3:94510612-94510634 TTGGAGACTCAATAAACAGGAGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
959108204 3:102090628-102090650 TTGGAAACCCAGAAATAGCGTGG + Intergenic
959614516 3:108332206-108332228 TTCCAGACTCAGAAAAATGGAGG + Intronic
959629677 3:108493729-108493751 TTAGAAAGTCAGAGAAAGGGGGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
960785205 3:121364985-121365007 ATAGAGACTCAAAAAAAGAGGGG - Intronic
961085350 3:124062687-124062709 TTGGTGCCTTAGAAAAATGGAGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962599073 3:136976799-136976821 TTTGGGTCTCAGAAAAAGTGTGG + Intronic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
963180736 3:142353021-142353043 TTAGAGACTCAGACAAAGAAAGG - Intronic
963832995 3:150028879-150028901 TTGGAGGCTCAGGGAAAGGGTGG + Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
965786538 3:172340794-172340816 TAGGAGACACAGAACAGGGGTGG - Intronic
965915456 3:173841054-173841076 TTAGACACTGAGAAAAAGTGGGG - Intronic
965923245 3:173945166-173945188 TTGGAAAATCTGAAAAAGGTGGG + Intronic
966825697 3:183963326-183963348 TTGGGAAATCAGAAACAGGGAGG - Intronic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
969699355 4:8758397-8758419 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970290186 4:14563493-14563515 TTGCTGATTCAGAAAAAGGAGGG + Intergenic
970417108 4:15869945-15869967 TGTAAGACACAGAAAAAGGGTGG - Intergenic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971470364 4:27018440-27018462 TTGGAGACTCAAAGCAAAGGAGG - Intronic
971921753 4:32949526-32949548 TTGGGGACTCAGGGAAATGGGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972081782 4:35161078-35161100 ATGGAGACTGAGAAAAACAGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972602779 4:40587388-40587410 TTGGAGACTGAGGGAAAGTGAGG - Intronic
972915793 4:43877934-43877956 TAGCAGACTAAGAAAAAGAGAGG + Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974272034 4:59662273-59662295 TTGGGGACTCAGAAGAAGACGGG + Intergenic
974713821 4:65639690-65639712 TGGGAGTCTCAGAAGAAGAGAGG - Intronic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
976191084 4:82487698-82487720 TTGGAAAATCAGCAAAATGGTGG + Intronic
976478779 4:85514664-85514686 TTGGAAAGTCAGAACAAAGGTGG - Intronic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978136797 4:105272324-105272346 TGATAGACTCAGAGAAAGGGTGG + Intronic
978523196 4:109637736-109637758 TTGGGGACTCGGGAAAATGGTGG + Intronic
978901273 4:113952435-113952457 TTGAAGACTCATAAAAAGCAAGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979000374 4:115209886-115209908 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979526546 4:121723769-121723791 TTGGAGAACCAAATAAAGGGTGG - Intergenic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
979780298 4:124643626-124643648 TTGCAGACTCAGAGAAAGCCAGG - Intergenic
980212597 4:129808974-129808996 TTGGGGACTCAGGGAAAGGTAGG - Intergenic
980359660 4:131748585-131748607 GGGGAGACACAGGAAAAGGGAGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
981168975 4:141599083-141599105 TTGGGGACTCAGGAAAAGAGTGG + Intergenic
981176955 4:141692810-141692832 TTGGAGGCTCAGAAGAAGACAGG - Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
982154912 4:152509353-152509375 TTTTAGACTCAGGAAAACGGTGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982488451 4:155998340-155998362 TTGGAAACTCAGAGGATGGGAGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
982954761 4:161749845-161749867 CTGGGGACTCCAAAAAAGGGAGG + Intronic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983729321 4:170973775-170973797 TTGGGGACTCAGGGAAAGGGTGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984457774 4:179992727-179992749 TTGGGGACTCAGGACAAGGACGG + Intergenic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985903608 5:2815691-2815713 TTGCAGACTCAAGAAAAGGAAGG - Intergenic
986019790 5:3790531-3790553 CTGGAAATCCAGAAAAAGGGAGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
987019955 5:13860070-13860092 AAAGAGACTCAGAAAAGGGGAGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987384768 5:17318723-17318745 TTTTAGACCCACAAAAAGGGGGG + Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987765174 5:22217845-22217867 TTGGAGAGTCAGAAAAGCAGTGG + Intronic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988559940 5:32271988-32272010 TTGGATATTAAGAAAAATGGGGG + Intronic
988912172 5:35854350-35854372 TTGGAGACTTAGAAAAGCTGAGG - Intronic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989392227 5:40912957-40912979 TTGGAGACTCAGAAGAGTTGGGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989685121 5:44076532-44076554 TTGGAGGATCAGAAAAAGAATGG - Intergenic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
991431090 5:66548036-66548058 TTAGAGCCTCAGAAAAAAAGAGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992466699 5:77013162-77013184 TTGGAGACGCACAAAAAGGCAGG - Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993366800 5:87043504-87043526 TTGAAGTCCCAGAAAAAGAGGGG - Intergenic
994019560 5:95007108-95007130 GAGGAGAATGAGAAAAAGGGGGG + Intronic
994028028 5:95107608-95107630 TGAGAGACTCAGAAAAGTGGAGG - Intronic
994325786 5:98443192-98443214 TGGGGGGCTCAGAAAAAGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994632464 5:102302838-102302860 TGAGAGAATCAGAAAACGGGAGG - Intergenic
995751081 5:115453829-115453851 GTGGAGATACAGAAAAAGTGAGG - Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996776626 5:127139702-127139724 TTGGAGTCCCTGGAAAAGGGAGG - Intergenic
997014404 5:129915008-129915030 TTGGAGACTAAGACAAAGAAGGG - Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997636730 5:135414476-135414498 TCGAAGACTCAGAAGCAGGGAGG + Intergenic
997795698 5:136808725-136808747 TTGAAGACTCTGTGAAAGGGTGG - Intergenic
997970022 5:138393428-138393450 TTATAGACTCAGAGAAAGAGTGG - Intronic
997996113 5:138587763-138587785 ATGGAGACACAAAGAAAGGGTGG - Intergenic
998296168 5:140970962-140970984 TTGTAGATTAAGAAAAATGGGGG + Intronic
998475663 5:142419347-142419369 TTGAAAAATCAGAAAAAGAGAGG + Intergenic
999001811 5:147931943-147931965 TTCCAGACTCAGAAATTGGGAGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999709262 5:154301977-154301999 TTGGTGACTCCAAAAAAGGGGGG - Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000367129 5:160502079-160502101 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001089232 5:168725058-168725080 TTGGAAACTGAGGAAATGGGGGG + Intronic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002787749 6:417332-417354 TTGGAGACCCAAACAGAGGGTGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005183125 6:23129848-23129870 TGGGAGACTCAACAAAATGGAGG + Intergenic
1005365610 6:25073689-25073711 TTGGAGACTCGGGGAAAGGGTGG - Intergenic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005591833 6:27336876-27336898 TTAAAGAGGCAGAAAAAGGGAGG - Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006339011 6:33435766-33435788 TGGGGGACTCAGAATAATGGGGG - Intronic
1007200280 6:40102201-40102223 TTGGGGACTCAGGGAAAGGGTGG - Intergenic
1007831530 6:44642469-44642491 TTTGGAACCCAGAAAAAGGGTGG + Intergenic
1008048771 6:46878703-46878725 TTGGAGAATTAGAAAAAGATGGG + Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012582631 6:100887680-100887702 TTTGGGACTCAGGGAAAGGGTGG + Intergenic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014096627 6:117468472-117468494 TTGGAGACTCGGGGGAAGGGTGG - Intronic
1015582786 6:134744802-134744824 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1015592418 6:134834780-134834802 TTGAAGACTATGAAAATGGGAGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015766622 6:136724692-136724714 ATGGTAACTCAGAAAAAGGTTGG + Intronic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016022891 6:139254640-139254662 TTTCAGACTCAAAAAAAGGGGGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017498343 6:155001165-155001187 TTGGTGACTGAGAAAATGGAGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1020623344 7:10545700-10545722 ATGGAGATTTGGAAAAAGGGGGG - Intergenic
1021076127 7:16306656-16306678 TTGAAGACCAAGAAAAAAGGCGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024584747 7:50832394-50832416 CTGGAAATTCAGAAATAGGGTGG + Intergenic
1024996116 7:55274230-55274252 TTGGAGAGTGAGGAGAAGGGAGG - Intergenic
1025164067 7:56695403-56695425 TTTGAGATTCAGAAAGAAGGTGG + Intergenic
1025706219 7:63866675-63866697 TTTGAGATTCAGAAAGAAGGTGG - Intergenic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028256210 7:88600968-88600990 TAGAAGACTGAGAAAATGGGTGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028404780 7:90463605-90463627 TTGGAGGCTCAGAAGAAGAGAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1028557191 7:92136747-92136769 ATGGGGACTCAGGGAAAGGGTGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031271389 7:119653893-119653915 TTGGAGAATAACAAAAAAGGTGG + Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031740465 7:125423365-125423387 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
1031803366 7:126276509-126276531 TGGAAGGCTCAGAAAAAGAGAGG - Intergenic
1033224880 7:139553598-139553620 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1033450624 7:141459537-141459559 TTAAAGATTCAGAAAAAGTGTGG + Intronic
1033892133 7:146026473-146026495 TTAGAGACTCAGAAGACGGGAGG - Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1035022852 7:155809282-155809304 TTAGAGACCCAGAGACAGGGAGG + Intronic
1035081083 7:156216546-156216568 TTGGAGACTCAGAGACAGACAGG - Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037224410 8:16567693-16567715 TGGGAAACACAGAAAAAGGAAGG + Intergenic
1038074891 8:24060993-24061015 TTGGGGACTCAGGAAAGGGTGGG + Intergenic
1038159001 8:25018974-25018996 TTGGATAGAGAGAAAAAGGGAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039264462 8:35809273-35809295 GTGGCCACTCAGAAAATGGGAGG - Intergenic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040370248 8:46763644-46763666 TTGGAGACTCGGGGGAAGGGTGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042157121 8:65856420-65856442 GTGGAGACTCACAAAATGGATGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1044505936 8:93019397-93019419 TTGGACAGTAAGAAAAATGGAGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1044996015 8:97838850-97838872 TGGGTAACTCAGAAAAGGGGCGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045841293 8:106584897-106584919 CTGGAGAGTAGGAAAAAGGGTGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046324389 8:112621494-112621516 GTGGAGATTGAGAAAATGGGAGG - Intronic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047392977 8:124469357-124469379 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047979491 8:130165766-130165788 TTGGAGAACCAGAAAAATAGAGG + Intronic
1048355288 8:133648904-133648926 GTGGGGAGTCAGGAAAAGGGAGG - Intergenic
1048600625 8:135915709-135915731 TTGGGGACTCAGGGAAAGGGTGG - Intergenic
1048929806 8:139304881-139304903 TTGGGGAATCATAAAAAGGGAGG - Intergenic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1050435959 9:5611016-5611038 TTGGGGACTCAGAGGAAGAGTGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050504154 9:6329693-6329715 TCTGAGACTCAGAAAAAGAGGGG + Exonic
1050950483 9:11584975-11584997 TTGGGGACTCAGGGAAAGAGTGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052178688 9:25498682-25498704 GTAGAGACTCAGAAAAATGTGGG + Intergenic
1052271515 9:26632753-26632775 TTGGATACCAAGAACAAGGGTGG - Intergenic
1052350988 9:27457998-27458020 TTGGAAATACAGAGAAAGGGTGG + Intronic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052806445 9:33017939-33017961 TTGGAGAGCCCGAAAATGGGAGG - Intronic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1056145201 9:83722233-83722255 TTGAAGCCTCTGACAAAGGGGGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058385017 9:104426094-104426116 ATAGTGATTCAGAAAAAGGGAGG - Intergenic
1058402718 9:104636508-104636530 GTGGAGACTCAGAAATGGAGAGG - Intergenic
1058751715 9:108045568-108045590 TTGCAGTCTCAGTAAAAGGCAGG - Intergenic
1059155637 9:111986273-111986295 GTGGAGAGTGAGAGAAAGGGAGG + Intergenic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059580731 9:115545800-115545822 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059580914 9:115547326-115547348 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059588059 9:115627651-115627673 TTGGAGCCTCAGACAATGGCCGG - Intergenic
1059814958 9:117901804-117901826 TGGCAGATTCAGAAAAAGGAAGG + Intergenic
1059989298 9:119849747-119849769 TTGGTAACTCAGAAAAAGCAAGG + Intergenic
1060037044 9:120264492-120264514 TTGGACACTCAGAATAGGGGAGG - Intergenic
1060200211 9:121648087-121648109 TTGGGGACTCAGGGAACGGGTGG + Intronic
1060338276 9:122748690-122748712 ATAGAGACTCAGAAGAAGTGGGG - Intergenic
1060790643 9:126483323-126483345 TTGGAGACTTAAAAAAATGCTGG - Intronic
1061779910 9:132989335-132989357 TTGGAGACCCAGACCCAGGGAGG - Intronic
1062227608 9:135462169-135462191 TTGGGAATGCAGAAAAAGGGAGG - Intergenic
1202801913 9_KI270720v1_random:8034-8056 TTGGGGACTCAGGGAAAGGCTGG + Intergenic
1203365275 Un_KI270442v1:250306-250328 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1185807351 X:3070731-3070753 TTGGGGACTCAGGGAAAGGGTGG - Intronic
1185827567 X:3266668-3266690 TTGGGGACTGAGGGAAAGGGTGG - Intergenic
1185955322 X:4482827-4482849 TTGGGGACTCGGGGAAAGGGTGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186046491 X:5542371-5542393 TTGGAGACTCAGAAAAAGCCTGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186226193 X:7401459-7401481 TAGGAGACTCTGAAAAATTGTGG - Intergenic
1186251466 X:7671437-7671459 TGGAAAACTCAGAATAAGGGTGG + Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187589325 X:20699194-20699216 TTGGGGACTCAGGGAAAGGATGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1187850718 X:23589130-23589152 TCAGAGACTCAGAAGAGGGGAGG + Intergenic
1187968385 X:24635506-24635528 TTAGTGACTCAGAAAAAAAGAGG - Intronic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188397948 X:29707771-29707793 TTGGGGACTCGGAGAAAGGGTGG + Intronic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189417494 X:40828009-40828031 TTGAAGTCTCTGACAAAGGGAGG - Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191174735 X:57486568-57486590 TTAGAAACAAAGAAAAAGGGTGG - Intronic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192164447 X:68818577-68818599 TTGGGAACTCAGGGAAAGGGTGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192327049 X:70141902-70141924 TTAGAGATTAAAAAAAAGGGGGG + Intronic
1192551480 X:72057865-72057887 CTACATACTCAGAAAAAGGGGGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193460624 X:81787265-81787287 TTAGAGGCTCAGAAAAAGACCGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193731821 X:85111415-85111437 TTGGAAACTCAGAATAAGACTGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194182962 X:90736190-90736212 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194280732 X:91950306-91950328 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1194371874 X:93083552-93083574 TTAGAAACTCAAAAAAAGAGTGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194469813 X:94279611-94279633 TTGGAGACTCGGGAAAGGGTGGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196320048 X:114275862-114275884 TTGGAGACTCGGAAAATGAGAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196934541 X:120716515-120716537 GTGAGGACTCAGAGAAAGGGAGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197621010 X:128748300-128748322 TTGGGGACTCGGGGAAAGGGTGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198097201 X:133391767-133391789 TTGCAGAGTCAGGGAAAGGGTGG + Intronic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198670305 X:139073137-139073159 TGTGAGACACAGAAAAGGGGGGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200529582 Y:4318147-4318169 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1200598216 Y:5173862-5173884 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200697388 Y:6373015-6373037 TGGGAGACTCATAAAAAAGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200812653 Y:7501560-7501582 GTAGAGACACAGAAAAGGGGTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201036725 Y:9791684-9791706 TGGGAGACTCATAAAAAAGAAGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic