ID: 1192103415

View in Genome Browser
Species Human (GRCh38)
Location X:68289827-68289849
Sequence TATTAAGTATGTCCACTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192103414_1192103415 -7 Left 1192103414 X:68289811-68289833 CCAATGATTGGGAAATTATTAAG 0: 1
1: 0
2: 0
3: 24
4: 301
Right 1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192103415 Original CRISPR TATTAAGTATGTCCACTTAA TGG Intronic
901202466 1:7474524-7474546 GATTCAGGATGTCCACTTACAGG - Intronic
902666089 1:17939538-17939560 TATTAAGTATTTCCAAGTGATGG - Intergenic
909544554 1:76831424-76831446 TATTAAGTATCTCAAAATAATGG + Intergenic
913260669 1:116995426-116995448 TGTTGAGTATCTCCACTTGAAGG - Intergenic
917864963 1:179185858-179185880 TATTAAGTATTTCAAGTTAATGG - Intronic
923180521 1:231514007-231514029 TATTAAATATGTGCATTTTATGG - Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1064579537 10:16779782-16779804 TAGTAAATATGTCCATTTGATGG - Intronic
1067850957 10:49753463-49753485 GAATAAATATGTCCACTTAGTGG + Intronic
1069140818 10:64822782-64822804 TATACAGTATGTTCAGTTAAGGG + Intergenic
1071046716 10:81387709-81387731 TATTCATTATTTCCACTTATAGG - Intergenic
1072184465 10:93022180-93022202 TTTCAAGTATGTGCACTTAGAGG + Intronic
1072394859 10:95028084-95028106 TAATAAGCATTTCCACTTATAGG - Intergenic
1073929515 10:108558288-108558310 TATTAAGTATGTATACATTATGG - Intergenic
1074089874 10:110240276-110240298 GACTAAGTATTTCCACTTACAGG - Intronic
1077864777 11:6212994-6213016 AATTAAGTATGTTGAGTTAAGGG - Intronic
1087425732 11:97983030-97983052 TATTAATTAAGTCAACTTCATGG + Intergenic
1090860084 11:130645205-130645227 TATTATTTATCTCCACTTAGTGG - Intergenic
1093205417 12:16243047-16243069 TAGTAAATATGTCCACATATGGG + Intronic
1093719066 12:22416877-22416899 AATAAAGGATCTCCACTTAATGG - Intronic
1098716711 12:73836016-73836038 TATTAAATATGCAAACTTAATGG + Intergenic
1102130397 12:110524193-110524215 TAATAATTATGCCCACTAAATGG + Intronic
1104705556 12:130943575-130943597 TATAAAGTATGTCCTCTTAATGG - Intergenic
1108978341 13:56478678-56478700 CATTAAGTATGTTTATTTAAAGG + Intergenic
1109351215 13:61184121-61184143 TTTTAAGTATGTGTACCTAAAGG - Intergenic
1112504344 13:99966788-99966810 TATTAAGTATTTCCATTTCCTGG - Intronic
1119623847 14:76153333-76153355 AATTAAATATTTCCCCTTAAGGG + Intronic
1122777725 14:104129562-104129584 GATCAAGGATGTCCACTGAACGG - Intergenic
1124815345 15:32985369-32985391 TTTTAAATATGTCAACTTTATGG + Intronic
1124896292 15:33780340-33780362 TAGTAAGTATCTCCCCTCAAAGG + Exonic
1125192712 15:37012193-37012215 TATGAAGCATGTCCAATAAAAGG + Intronic
1127401783 15:58594277-58594299 TATTAAGTATTTCTAATTGAAGG - Exonic
1127511929 15:59651146-59651168 TATTAAGTATTTCCATTTGTTGG - Intronic
1134465234 16:14470284-14470306 AATTCAGTATTTCCATTTAAAGG - Intronic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1138653981 16:58479974-58479996 TACTAAGTCTGTCCCCTTTAGGG + Intronic
1149664041 17:58353328-58353350 TATTAAGTAGGCCCATTTTATGG + Intronic
1150211156 17:63442248-63442270 TATCAATTATGTCCAATGAATGG - Intronic
1150664776 17:67122950-67122972 TATTTCGAATGTCCACTTACAGG + Exonic
1151083101 17:71351205-71351227 TAGGAAGTATGACCTCTTAAAGG - Intergenic
1152023824 17:77796170-77796192 ATTTAAGTATGTACATTTAATGG + Intergenic
1156374545 18:36501533-36501555 TATAAACTATTTCCACTTGATGG - Intronic
1159114049 18:64093059-64093081 TATTTTGCATGTCCACTGAATGG + Intergenic
1159276501 18:66228809-66228831 TATTAAGTATGTGAAGCTAATGG + Intergenic
1159767304 18:72505646-72505668 TATTAATTAATTCCACTTAATGG + Intergenic
1163394206 19:17049566-17049588 AATAAAGTATGTCCACTCGAGGG + Intergenic
1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG + Intergenic
924959935 2:25531-25553 TATGAAGTATGTCCACACAATGG - Intergenic
926551535 2:14307594-14307616 AATTAACTATGTCCTCTTCAAGG - Intergenic
927527114 2:23755016-23755038 TAATAAGCATATCCACTAAAAGG + Intronic
927627018 2:24732524-24732546 TTTTACATGTGTCCACTTAAGGG + Intronic
934922042 2:98352237-98352259 AATGTAGTATGTCCACATAATGG - Intronic
937714832 2:125020353-125020375 TTTTAAGTTGGTGCACTTAATGG + Intergenic
937794231 2:125998117-125998139 TATTAAGTCTGTGAAGTTAAAGG - Intergenic
939658361 2:144855441-144855463 TATTGAATATGTTAACTTAAGGG - Intergenic
940361493 2:152800690-152800712 TAATAAGTATTTTCAATTAAAGG + Intergenic
941017212 2:160370885-160370907 TGTTAATTAAGTCAACTTAAAGG - Intronic
943661277 2:190561983-190562005 TATTAAGAATATCCAGTCAAGGG - Intergenic
1169714968 20:8605397-8605419 TATTAAGTGTGTTCAATTAAGGG - Intronic
1179043465 21:37825164-37825186 TATAAAGTTTGGCCATTTAAAGG + Intronic
1179390447 21:40984875-40984897 TTTCTAGTATGTGCACTTAATGG - Intergenic
1181613346 22:24034466-24034488 AATGAAGTATGTCCATATAAAGG - Intronic
949277306 3:2299603-2299625 TATTAAGTATGTTTATTTTAGGG + Intronic
951393193 3:22131967-22131989 TATTAAGTATGTTCACCTGTAGG + Intronic
952485029 3:33801078-33801100 TATTAAGTATTTTCACTTTTTGG + Intronic
952888096 3:38024212-38024234 TACTAAACATGTCCAATTAAAGG + Intronic
953528747 3:43718270-43718292 TATTAAGTATATCCATTAAAAGG - Intronic
954489030 3:50883869-50883891 GAAAAAGTATGGCCACTTAATGG - Intronic
955312679 3:57905140-57905162 TCTTAAGTCTGTCCACTGAGTGG - Intronic
970522915 4:16903532-16903554 GGGTAAGTATTTCCACTTAAAGG - Intergenic
972075610 4:35082466-35082488 TATTTAGTAAGTCTACTTAAGGG - Intergenic
975285416 4:72612566-72612588 TATTTAGTATATACACTAAATGG + Intergenic
975373696 4:73617635-73617657 TAATAAGGATGTTAACTTAAAGG - Intronic
976642606 4:87354708-87354730 TATTCAGTGTGGCCACTTGAAGG - Intronic
977249035 4:94668177-94668199 TATTGAGTATGTGCACATTATGG - Exonic
978705651 4:111706889-111706911 TCTGAAGTTTGGCCACTTAAAGG + Intergenic
982058282 4:151575604-151575626 TATTAAAAATGTCAACTTAAGGG + Intronic
982629609 4:157815344-157815366 TATTAAGTCTGTGCTCTGAATGG - Intergenic
984354839 4:178644560-178644582 TATTAAGGAATTCCTCTTAAGGG - Intergenic
986945342 5:13011780-13011802 TATTAAAAATGACCACTTACAGG + Intergenic
988412312 5:30902484-30902506 AATGGTGTATGTCCACTTAAAGG + Intergenic
990498420 5:56371849-56371871 AATTTGGTATGTCCACTTTAGGG - Intergenic
994326298 5:98449862-98449884 AATTAAATATGTTCATTTAATGG + Intergenic
996555544 5:124775208-124775230 ATTTAAGTATGTCCATATAATGG + Intergenic
998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG + Intronic
999036179 5:148353101-148353123 TTTTAAGTAATTGCACTTAAAGG + Intergenic
1009543194 6:64992505-64992527 TATAAAATATATCCATTTAAAGG + Intronic
1009724010 6:67512273-67512295 TATTAATTATTTCAATTTAAAGG - Intergenic
1014585818 6:123196469-123196491 TTATAAGTATATTCACTTAATGG - Intergenic
1014997248 6:128164112-128164134 AATTACGTATCTCCAATTAATGG + Intronic
1015215115 6:130741122-130741144 TATTAACTATCCCCACTTCATGG - Intergenic
1015665216 6:135620480-135620502 TATAAAATAGGTCCACATAAAGG - Intergenic
1016489177 6:144577636-144577658 TATTAAGTATGTATAATAAATGG - Intronic
1021423819 7:20475751-20475773 TATTTCTTATGTCCACATAAAGG - Intergenic
1024126080 7:46295967-46295989 TATTAACTATAGCCAGTTAATGG + Intergenic
1026215267 7:68342887-68342909 TGTTAAGTATGTTCCCTTTAGGG + Intergenic
1026669757 7:72379361-72379383 AATAAAGTATATCCAATTAATGG + Intronic
1026670274 7:72384195-72384217 TTTTATGTAAGTCCACATAATGG - Intronic
1031060580 7:117046842-117046864 TATTAAGTACATGGACTTAATGG + Intronic
1031335671 7:120528432-120528454 TATTAAATCAATCCACTTAAAGG + Intronic
1031787397 7:126050465-126050487 TATTAAATATGTATACTTATGGG + Intergenic
1031837690 7:126698127-126698149 TATTCAGGATGTCAAATTAAAGG + Intronic
1032069711 7:128796590-128796612 TCTTAAGTGTTTCCACTTAGTGG - Intronic
1032180513 7:129672801-129672823 TATTTTGTATCTCCACTTAATGG - Intronic
1032319240 7:130870177-130870199 AATGAAGAATGTCTACTTAATGG + Intergenic
1032382018 7:131494889-131494911 TATAAAGTATGTACGCATAAAGG - Exonic
1032521904 7:132551887-132551909 TAATTAGTATGTTCATTTAAAGG - Intronic
1033840504 7:145367922-145367944 AATTAAGTATTTCCTCATAAGGG + Intergenic
1035431225 7:158823720-158823742 TATTCAGAATGTCTACTTCAAGG + Intronic
1037029663 8:14089020-14089042 TATTAAGTATTTCCTATTATGGG - Intergenic
1038257190 8:25960826-25960848 AATTAATGAAGTCCACTTAAAGG + Intronic
1039211730 8:35224341-35224363 TATTTAGTATGGTCACTTGAAGG + Intergenic
1043673166 8:82914350-82914372 CATTAATTATGTCCACTAAGGGG + Intergenic
1043798358 8:84575665-84575687 TATTAAGCATGTCGAACTAATGG + Intronic
1045413170 8:101940355-101940377 TGTTATATATGTCCACATAAGGG - Intronic
1047919783 8:129622928-129622950 TAATAAGTATGTCGCATTAATGG + Intergenic
1050604268 9:7284469-7284491 TAAAAAGGATGTCCACTTAAAGG + Intergenic
1051907313 9:22110369-22110391 TATTAGAAATGTCAACTTAATGG - Intergenic
1052468418 9:28860364-28860386 TATTAAGGATTTCAACTTATAGG - Intergenic
1053258919 9:36644105-36644127 TATTTGGTTTGTCCACTTAGGGG - Intronic
1060385007 9:123217567-123217589 TTAAAAGCATGTCCACTTAAAGG + Intronic
1060673899 9:125494994-125495016 GATGAAGCATGACCACTTAAGGG + Intronic
1186243585 X:7596349-7596371 TTTTAAGTATGTACACATATTGG - Intergenic
1187133359 X:16524361-16524383 TATTAAAAATGTCCAATAAATGG - Intergenic
1189658377 X:43270909-43270931 TTTTAATTATTTCCACTCAATGG - Intergenic
1192085157 X:68088753-68088775 TATGAAGTATGTCTAATTATTGG + Intronic
1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG + Intronic
1193464756 X:81834734-81834756 TATTAAATATGTCTTCTTCATGG + Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1201972868 Y:19815949-19815971 TATTAAGTATCCCTATTTAAAGG - Intergenic