ID: 1192112737

View in Genome Browser
Species Human (GRCh38)
Location X:68381877-68381899
Sequence ACACTGGGACAGAAGCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192112737 Original CRISPR ACACTGGGACAGAAGCAATG TGG (reversed) Intronic
901586385 1:10297329-10297351 TCATTGAGACAGAAGCAATTTGG - Intronic
901601559 1:10426936-10426958 ACCCAGGGACAGAAACACTGCGG + Intergenic
902592368 1:17484254-17484276 TCACTGGGAAAGAAGCATTCAGG + Intergenic
904905925 1:33897128-33897150 GCACTGAGGCACAAGCAATGAGG + Intronic
905316071 1:37081969-37081991 ACACAGGGACACAAACACTGCGG + Intergenic
905809524 1:40901962-40901984 ACACCAGCAGAGAAGCAATGGGG - Intergenic
905872969 1:41415574-41415596 GCACTTGGACAGACACAATGAGG - Intergenic
906628378 1:47344295-47344317 ACAGTGGGAAAGAAGCAGTTGGG + Intronic
906958747 1:50400361-50400383 ACACTGGCACATAAAAAATGTGG - Intergenic
907205665 1:52768403-52768425 CAAATGGGACAGAAGAAATGAGG - Intronic
907555570 1:55341115-55341137 TCACTGACACATAAGCAATGTGG - Intergenic
909915652 1:81315349-81315371 ACATTGGGAAAAAAGCAATCTGG - Intronic
912940922 1:114043959-114043981 ACACTGGGAGAGAAACAGTTTGG - Intergenic
913479638 1:119275336-119275358 GCACTGGTATAGGAGCAATGAGG + Intergenic
915023273 1:152802323-152802345 ACACTGGAACAGTATCAAGGAGG + Intronic
915100578 1:153496000-153496022 ACCCTGGGAGAGAAGCATTTGGG - Intergenic
915774885 1:158472173-158472195 AGAATGTGTCAGAAGCAATGTGG + Intergenic
916676157 1:167065870-167065892 ACCCTGGGACTGGAGCAGTGTGG + Intronic
917725773 1:177825770-177825792 GCACTGGAACACAGGCAATGAGG - Intergenic
921171248 1:212551824-212551846 ACCCCGAGACAGAAGCACTGAGG - Intergenic
922204003 1:223430904-223430926 ACACTGGGCCAGAGGGGATGGGG + Intergenic
922468537 1:225861529-225861551 ACACTGGGGCAGGAGGAAAGGGG - Intronic
923877632 1:238066691-238066713 TCACCAGGACAGAAGCAATGAGG - Intergenic
924454054 1:244203880-244203902 TCACAGGGAAAGAAGAAATGAGG - Intergenic
1064337382 10:14456275-14456297 ACAGTGAGAGAGAAGAAATGGGG - Intronic
1065804931 10:29385430-29385452 ACCCTGGGACAGATGAACTGTGG - Intergenic
1066236007 10:33485392-33485414 TCACTGGGAAAGAATAAATGGGG - Intergenic
1066686948 10:37990717-37990739 ACAGTGGGAGAGAGGAAATGGGG - Intergenic
1068743372 10:60500637-60500659 TCACTGGCACAGAAGCAACTGGG + Intronic
1069019046 10:63465503-63465525 ACACAGGGACAGCCGCAATCCGG - Exonic
1072746143 10:97940600-97940622 TCACTGGGACAGCACCACTGTGG + Intronic
1073732250 10:106303147-106303169 ACACTGCAACACAAGCAATCTGG - Intergenic
1074252216 10:111762461-111762483 AGACTGGGACAGAGGCCAAGGGG + Intergenic
1074464356 10:113668338-113668360 TCAGAGGGACAGAACCAATGGGG + Intergenic
1076070924 10:127488484-127488506 ACACTGGGTAGGAAGCAGTGGGG - Intergenic
1076682625 10:132181821-132181843 ACGCTGGGACAGAGGCAGAGGGG - Intronic
1078773726 11:14375044-14375066 AGACTGGGATGGAAGTAATGTGG + Intergenic
1080975948 11:37340656-37340678 ACAGTGGGACATAAGGAAAGAGG - Intergenic
1081498849 11:43645267-43645289 ACATTGTGGCAGAAACAATGAGG - Intronic
1086104625 11:83134023-83134045 ACCCAGGGACACAAGCACTGCGG + Intergenic
1086434767 11:86770331-86770353 ACCCAGGGACACAAGCACTGCGG - Intergenic
1089568815 11:119388647-119388669 AAACTACGACAGAAGCAATGTGG - Intergenic
1092455073 12:8635930-8635952 ACACAGGGACACAAACACTGCGG + Intergenic
1092685170 12:11035232-11035254 CAAATGGGGCAGAAGCAATGTGG - Intronic
1092687374 12:11065378-11065400 AAAATGGGCCAGAAGCATTGTGG - Intronic
1092689860 12:11096139-11096161 CAAATGGGGCAGAAGCAATGTGG - Intronic
1096263524 12:50107123-50107145 AAAATGGGACAGGAGCAAGGGGG - Intronic
1096977753 12:55708904-55708926 AGGCTGGGACAGAGGCAAGGGGG + Intronic
1099624556 12:85053239-85053261 AGAATGGGGCAGAAGCAAAGAGG + Intronic
1100693606 12:97066044-97066066 AGCCTGGGAAAGAAGGAATGGGG + Intergenic
1101295789 12:103422578-103422600 ACACTGGGACATTTGCATTGAGG - Intronic
1101765193 12:107691525-107691547 AAATTAGGCCAGAAGCAATGAGG + Intronic
1102649647 12:114430368-114430390 AAACTGGGCCAGAATCACTGGGG + Intergenic
1103295318 12:119881390-119881412 ACACTGGCTCAGATGCAAAGTGG + Intergenic
1103656283 12:122473706-122473728 AAACTGTGACATCAGCAATGGGG - Exonic
1104035893 12:125096923-125096945 AGACTGGGACAGAAGCATCCAGG - Intronic
1104572609 12:129938316-129938338 ACCCTGGGAAGGAAGCAAAGAGG - Intergenic
1104997631 12:132668500-132668522 GCACTGGGAAGGAGGCAATGGGG + Exonic
1108165417 13:47688020-47688042 TCACTGGGATAGATCCAATGAGG + Intergenic
1109158401 13:58940692-58940714 AGACTGGGACAGAAGGCTTGGGG - Intergenic
1113878147 13:113607542-113607564 ACACAGTGACGGCAGCAATGAGG - Intronic
1114475792 14:22993856-22993878 GCTCTGGGACAGAATCAAAGAGG - Intronic
1116266951 14:42704375-42704397 ACACTGGGAACAAAACAATGTGG + Intergenic
1118182782 14:63509847-63509869 CCACTGGGACCTAAGCAATTTGG + Intronic
1121385873 14:93524650-93524672 ATACTAGGACAGAACCAATTTGG - Intronic
1123138481 14:106052435-106052457 ACACTCAGACAGTTGCAATGAGG - Intergenic
1124022815 15:25939577-25939599 ACCCCGGGACAGAAACAGTGGGG + Intergenic
1124634694 15:31357558-31357580 ACACTGGGAGAGAAGCTGGGAGG + Intronic
1125788354 15:42342733-42342755 GCACTTGGAAAGGAGCAATGGGG + Intronic
1126741048 15:51776322-51776344 ACACTGGGGAAGAATGAATGCGG - Intronic
1126795104 15:52254108-52254130 ACAGGAGGACAGCAGCAATGTGG + Intronic
1126923943 15:53560870-53560892 ACACAGGGAGAGAATGAATGAGG + Intronic
1127006127 15:54572015-54572037 ACACTGGGAAAGGAGCCAGGAGG - Intronic
1130105813 15:80927766-80927788 ACTGGGGGACAGAAGCAATGAGG + Intronic
1131025549 15:89138291-89138313 ACACTGGGAGTGAAGCTTTGTGG - Intronic
1132839700 16:1972966-1972988 AGGCTGGGACAGGAGCAGTGGGG + Intronic
1132841328 16:1979714-1979736 AGACTGGGCCAGAAGCACCGCGG - Exonic
1133115515 16:3576090-3576112 ACCCTGGGACAGAAGAAGAGGGG + Intronic
1133536922 16:6711281-6711303 TCAGTGAGACAGAAGCCATGGGG - Intronic
1134402395 16:13921311-13921333 ACACTGAGAAAGATGGAATGGGG + Intronic
1134444349 16:14319677-14319699 GAACTGGGGCAGAATCAATGTGG + Intergenic
1137876688 16:52003624-52003646 ACACTGGGACCTCAGAAATGGGG - Intergenic
1139745910 16:69074133-69074155 ACACTGGGCTAGGAGCATTGAGG + Intronic
1142114273 16:88348271-88348293 AGGCAGGGACAGCAGCAATGTGG - Intergenic
1145213608 17:21035063-21035085 ACACTTGGACGGAAGCAAACTGG + Intronic
1146516621 17:33494640-33494662 ACACTGAGGTAGGAGCAATGGGG + Intronic
1146679786 17:34798757-34798779 TCTCTGGGAAAGCAGCAATGGGG - Intergenic
1147600331 17:41741164-41741186 ACACTGGGGCAAAAGCAAGAAGG + Intergenic
1149310431 17:55387694-55387716 TCACTGGGAAAGAAACAAGGTGG + Intergenic
1150850744 17:68701602-68701624 AAACTGGGACAAAACCAAGGTGG + Intergenic
1151388059 17:73767535-73767557 CCACTGGGACATGAGCAAGGTGG + Intergenic
1152837713 17:82545050-82545072 CCACTAGGTCAGCAGCAATGGGG - Intronic
1153543926 18:6186466-6186488 AAAATGGGACCGAAGAAATGGGG + Intronic
1154124965 18:11683882-11683904 ACACAGGGACAGAAGAAAGAAGG + Intergenic
1155154871 18:23149740-23149762 CCACTGGGTCAGAAGCTCTGGGG + Intronic
1155807914 18:30195367-30195389 ACAGAGGGACAAAAGCAGTGTGG - Intergenic
1157226949 18:45874837-45874859 ACCATGGGCCAGAAGCAAAGAGG + Intronic
1157635813 18:49153294-49153316 TCACTGGGACCTAATCAATGTGG + Intronic
1163653405 19:18531949-18531971 AAACTGGGTCTGAAGGAATGAGG + Exonic
1164698236 19:30262790-30262812 CCACTGGGACACAAACAAGGAGG - Intronic
1165333745 19:35155202-35155224 TCACTGGGACTGACGCAAGGAGG - Exonic
925060772 2:888480-888502 TCACTCGGAAAGAAGCACTGAGG + Intergenic
926073275 2:9918676-9918698 GCATTGGGACAAAGGCAATGAGG + Intronic
926552415 2:14316323-14316345 TCACTGGGACAGAAGCAACTAGG + Intergenic
926665855 2:15522224-15522246 AAATTGGGTCAGAAGTAATGAGG + Intronic
928226686 2:29455364-29455386 ACCCTGGGAGAGCAGCAAGGTGG + Intronic
928843764 2:35644041-35644063 AGCCTTGGACAGAAGCAATGTGG + Intergenic
934514483 2:94977674-94977696 ACACAGGGAAAGAAGCAAAAAGG - Intergenic
935274401 2:101463647-101463669 ACACTGGGACAGTCCCAAGGGGG + Intronic
937015210 2:118598892-118598914 TCACTGGGAGAGAAGCCATGTGG - Intergenic
937050608 2:118885354-118885376 ACACTGGTGCAAAAGCAATATGG - Intergenic
938139882 2:128786861-128786883 ACACAGGGAAAGAAACAATGAGG - Intergenic
941318581 2:164026152-164026174 AGACTGAGACAGAAGAAAGGAGG + Intergenic
941719225 2:168795854-168795876 AAACTGTGGCAGAAGCAGTGGGG - Intronic
943088971 2:183351653-183351675 ATATTGGGAAAGGAGCAATGGGG + Intergenic
948568920 2:238905143-238905165 ACAAAGGGACAGAAGCATTACGG - Intronic
1168781450 20:494757-494779 AAGCTGGGACAGAATGAATGCGG - Intronic
1169993161 20:11526056-11526078 ACACTGTGACAGAATAGATGAGG + Intergenic
1171299813 20:24050367-24050389 AGGCTGGGACACAGGCAATGAGG + Intergenic
1172301631 20:33854608-33854630 ACACTGGCAGAGAAGAAATAGGG - Intergenic
1173113553 20:40218570-40218592 TCACTGGAACAGAAGCAGAGAGG - Intergenic
1174243345 20:49156631-49156653 ACACTTGGAAATCAGCAATGGGG - Intronic
1176985642 21:15432472-15432494 ACACTGGGAAATAAGCAAGCAGG - Intergenic
1177836971 21:26195392-26195414 AGAGTGGGAAAGAAGCAATCTGG + Intergenic
1181102382 22:20550119-20550141 ACTCAGGAACAGAAGCAAGGTGG - Intronic
1181204078 22:21237986-21238008 ACACTAGGACAGAAACTGTGAGG + Intergenic
1182285337 22:29243704-29243726 AGACTGAGACAGAAGGCATGGGG - Intronic
1182886219 22:33776331-33776353 ACACAGGTACAGAAGCAAATGGG + Intronic
1183868576 22:40723546-40723568 ACAGTGGGACAGAGGCGGTGGGG + Intergenic
1203222843 22_KI270731v1_random:57429-57451 ACACTAGGACAGAAACTGTGAGG - Intergenic
1203267986 22_KI270734v1_random:29384-29406 ACACTAGGACAGAAACTGTGAGG + Intergenic
952973666 3:38674700-38674722 AGACTATGACAGAAGAAATGTGG + Intergenic
953569234 3:44058156-44058178 GCAGTGGGACAGAAGCAAGGAGG - Intergenic
953681870 3:45045129-45045151 ACACTTTGAAAGAAGCAATGTGG - Intergenic
953837792 3:46362206-46362228 ACACTGTGACAGAAGGAGTATGG + Intergenic
954632479 3:52055072-52055094 ATACAGGGACAGGAGAAATGGGG + Intronic
959369279 3:105503728-105503750 CACCTGGGAAAGAAGCAATGGGG - Intronic
960142301 3:114162897-114162919 ACCCTGGGATAGAGGCAATCAGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960295804 3:115942462-115942484 ACACTGTTACAGAAACACTGTGG + Intronic
960297178 3:115958647-115958669 ACACTGAGTCAGAGGCAGTGGGG - Intronic
960637532 3:119798115-119798137 AGAATCGGACAGAAGCAATCTGG - Intronic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
961998205 3:131268879-131268901 TCCCTGGGACAGAGCCAATGGGG - Intronic
962479114 3:135783064-135783086 GCTCTGAGAGAGAAGCAATGTGG + Intergenic
964647784 3:158977170-158977192 ACACTGAGATAGAAGCTGTGGGG + Intronic
965094183 3:164202256-164202278 ACACTGGGACTGAAGTAATGTGG + Intergenic
966327002 3:178767999-178768021 AGACTGGGCAAGAACCAATGTGG - Intronic
968715193 4:2152787-2152809 ACACTAAGACAGAAACAATGAGG + Intronic
968942066 4:3644052-3644074 ACACAGGGACGGAGGCCATGTGG + Intergenic
968947220 4:3671356-3671378 ACACAGCGACAGCAGCAAGGCGG - Intergenic
969342991 4:6553911-6553933 ACACTGGGACCGAGGCCATTTGG - Intronic
971146560 4:23983022-23983044 TCATTGCAACAGAAGCAATGTGG + Intergenic
972288558 4:37669880-37669902 ACCCAGGGACACAAACAATGCGG + Intronic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
974019022 4:56676730-56676752 ACATTGTGACAGCAGCAGTGGGG - Intronic
977853103 4:101854227-101854249 ACTATGGCACAGAACCAATGTGG - Intronic
979781214 4:124653141-124653163 TCAGTGAGACAGAAGCAATCAGG + Intergenic
981390090 4:144179437-144179459 ATACTGAGGCAGTAGCAATGGGG + Intergenic
982204114 4:152984257-152984279 TCACTAGGACAGCAGGAATGTGG - Intergenic
982509986 4:156270078-156270100 AAACTGGGATAGAAGGAATATGG + Intergenic
982815010 4:159873673-159873695 AAACTTGGACAAAAGCAATCGGG - Intergenic
983413413 4:167425398-167425420 TCATTGGGGCAGTAGCAATGAGG - Intergenic
986151104 5:5131216-5131238 GCACTGGGACAGAAGGCATCAGG + Intergenic
987853992 5:23394554-23394576 ACACTGAGACAAAAGGATTGCGG - Intergenic
988933986 5:36064855-36064877 TCACTGGAACAGAAGGAATGAGG + Intronic
994735156 5:103544779-103544801 AGACTGGGGCAGAAGCAGTATGG + Intergenic
996981221 5:129497658-129497680 ACAGTGGCACAGAAGAATTGAGG - Intronic
997347452 5:133202274-133202296 ACCATGGGGCAGAAGCAATTCGG - Intronic
997369180 5:133346622-133346644 CCACTGAGACAGAAGCAGGGGGG - Intronic
998042619 5:138962162-138962184 AAACTGGCACAGAAGCAAACTGG - Intronic
1001424258 5:171613145-171613167 TGACTGGGAAAGGAGCAATGGGG - Intergenic
1004733798 6:18384780-18384802 TGACTGGAACAGAAGCAAGGCGG - Intergenic
1004755031 6:18601709-18601731 TCACTGTGACAGGAGCAGTGTGG + Intergenic
1005816992 6:29561437-29561459 ACACTGGGTAAGAAGCAAGGAGG - Intronic
1006573523 6:35025567-35025589 AGATAGGGACAGCAGCAATGGGG - Intronic
1007408886 6:41650125-41650147 ACTCTGGGAAAGAAGGGATGGGG - Intronic
1008561898 6:52732249-52732271 ACATTGAGACAGCTGCAATGAGG - Intergenic
1013668774 6:112375608-112375630 ACACAAGGACAGAAGGAATTTGG + Intergenic
1013815411 6:114091833-114091855 ACACTGGGGAACAAGCAAAGAGG + Intronic
1014384983 6:120789009-120789031 ACACTGGGGAAGACGCAAGGAGG - Intergenic
1016712776 6:147192498-147192520 ACACTGGCACTGTTGCAATGTGG + Intergenic
1018106134 6:160488186-160488208 ACTCTGGGACTGAAGGAATGGGG + Intergenic
1018363658 6:163097360-163097382 CCACTGGTCCAGAAACAATGGGG - Intronic
1019268805 7:134400-134422 AGACTGGGACAGAAGCTTAGTGG - Intergenic
1019387906 7:768889-768911 AAACTGGGTCAGAAGCAGCGTGG + Intronic
1020038461 7:4981730-4981752 ACCCTGGGGCAAAAGCAGTGGGG - Intergenic
1020156841 7:5732734-5732756 ACCCTGGGGCAAAAGCAGTGGGG + Intronic
1021089809 7:16470357-16470379 AACCTGGCACAGAAGAAATGTGG + Intronic
1021803615 7:24333005-24333027 ACACTGGGAGAGCTGCAATGGGG + Intergenic
1022389363 7:29929658-29929680 ACAGTGGGTCAGACGCAAAGCGG - Intronic
1023836617 7:44072442-44072464 TCACTGAGGCAGAAGCACTGAGG - Exonic
1026395594 7:69950663-69950685 ACACTGGACCAGAAGTCATGTGG - Intronic
1029627271 7:101727810-101727832 ACACTGAGGCAGAAACAAGGGGG + Intergenic
1032428673 7:131842950-131842972 ACACTGGGCTAGAGGCATTGTGG + Intergenic
1032503770 7:132420160-132420182 ACAGAGGCACAGGAGCAATGTGG - Intronic
1033169689 7:139072616-139072638 ACACTGAGACAGAAGGACAGAGG + Intronic
1033573711 7:142659150-142659172 GCACTGAGGTAGAAGCAATGAGG - Intergenic
1034901698 7:154911699-154911721 ACACTGGGAGATAATCAGTGTGG + Intergenic
1035169204 7:157008684-157008706 CCACTCAGACAGAAACAATGGGG + Intronic
1036055920 8:5253688-5253710 ACACTGAGACAGAAGTGAAGAGG - Intergenic
1040643157 8:49364756-49364778 ACATTGGAACAGAAGTAAGGTGG - Intergenic
1043240332 8:77925443-77925465 GCACTTGGGCAGAAACAATGGGG - Intergenic
1045395698 8:101758617-101758639 ACATGGGGACAGAAGACATGTGG - Intronic
1045921926 8:107540402-107540424 ACACTGGGAGGGAGGTAATGGGG + Intergenic
1046592901 8:116227288-116227310 CGACTGGGATAGAAGCCATGTGG + Intergenic
1047757397 8:127929087-127929109 ACTTTGGGACAGAAGCAAGGGGG + Intergenic
1048160302 8:132014374-132014396 ACACTGGGACATAGGCAACTGGG + Intergenic
1048838868 8:138547146-138547168 ACACTGGGATTTAGGCAATGAGG - Intergenic
1048853499 8:138666559-138666581 ACACCTTGACAGAAGCAGTGAGG - Intronic
1050885165 9:10755171-10755193 ACACTGGCACAGTAGCATTTGGG - Intergenic
1051156781 9:14156785-14156807 ACCCTAGGACAGAAGCAAGTAGG - Intronic
1052886314 9:33651527-33651549 GCACTGAGGTAGAAGCAATGAGG - Intergenic
1053195082 9:36111250-36111272 ACACTGGGTCCCAAGAAATGTGG - Intronic
1055918143 9:81428285-81428307 ACACTGAGACAGAGGAAATACGG + Intergenic
1056507008 9:87267184-87267206 ACACTGGAACAGAAGCCCAGAGG + Intergenic
1057345286 9:94245151-94245173 AGACTAGGAAAGAAGGAATGGGG + Intergenic
1058483792 9:105423029-105423051 AAACTGGGACGGAAGGAAAGAGG + Intronic
1058650343 9:107170079-107170101 ACACTTGGAAGGAAGCTATGTGG - Intergenic
1187212398 X:17244427-17244449 ACACAGGGACACAAACACTGTGG - Intergenic
1189221194 X:39373704-39373726 ACACTGACATTGAAGCAATGGGG + Intergenic
1189258719 X:39661327-39661349 AGACTGTGGCTGAAGCAATGTGG - Intergenic
1190733732 X:53241556-53241578 ACACAGGGACAGAAAATATGAGG - Intronic
1190879496 X:54482710-54482732 ACACTGGGACAAACACAAGGAGG + Intronic
1191008502 X:55737215-55737237 ACACTGGGACAAAAGCATGATGG - Intronic
1191257094 X:58284262-58284284 GGCCTGGGACAAAAGCAATGAGG - Intergenic
1191819150 X:65283780-65283802 ACACTGGGACTGGAGCATTATGG + Intergenic
1191952813 X:66612262-66612284 ACACTGGGAAAGAAAAAATATGG + Intronic
1192112737 X:68381877-68381899 ACACTGGGACAGAAGCAATGTGG - Intronic
1192903403 X:75523422-75523444 AGACTGAGACAGAAACAAAGAGG - Intronic
1193985554 X:88237144-88237166 ACTCTGGGAGACAAGCAAAGCGG - Intergenic
1194917619 X:99723962-99723984 CCACTGGTACAGAAGCTATGAGG - Intergenic
1196087118 X:111695544-111695566 ACACTGGCACACAAACACTGAGG - Intronic
1196112472 X:111962068-111962090 ACACTGGGACTCCAGAAATGGGG + Intronic
1196736319 X:118983743-118983765 ACACTGGGACAGAAACCGTAAGG - Intronic
1199578044 X:149333764-149333786 AAACTATGACACAAGCAATGAGG + Intergenic
1200116655 X:153772522-153772544 AGCCTGGGACAGGAGCAGTGAGG + Intronic
1201558871 Y:15293485-15293507 ACAGTGGGTCAGGAGCAGTGGGG + Intergenic
1201750406 Y:17425560-17425582 ACACTCAGACAGTAGCAAAGTGG + Intergenic
1202062384 Y:20900894-20900916 TCACTGGAACAGAAGCACAGTGG - Intergenic