ID: 1192116693

View in Genome Browser
Species Human (GRCh38)
Location X:68418395-68418417
Sequence CTGTGTGCAAAGATGGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192116691_1192116693 15 Left 1192116691 X:68418357-68418379 CCGAGGAGGATACATGACAGGGT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG 0: 1
1: 0
2: 2
3: 33
4: 209
1192116689_1192116693 16 Left 1192116689 X:68418356-68418378 CCCGAGGAGGATACATGACAGGG 0: 1
1: 0
2: 3
3: 15
4: 157
Right 1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG 0: 1
1: 0
2: 2
3: 33
4: 209
1192116687_1192116693 17 Left 1192116687 X:68418355-68418377 CCCCGAGGAGGATACATGACAGG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG 0: 1
1: 0
2: 2
3: 33
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192116693 Original CRISPR CTGTGTGCAAAGATGGTATT AGG Intronic
901089592 1:6632502-6632524 CTGAGTGCAAAGGTGGTCTGTGG + Intronic
901929467 1:12587795-12587817 CTGTGTGTAAAGAATCTATTTGG - Intronic
903654244 1:24939371-24939393 GTGTGTGCAAAGATGCTCCTAGG + Intronic
904649371 1:31993108-31993130 CTATGTGCAAATTAGGTATTTGG - Intergenic
909398538 1:75198241-75198263 CTGGGTGCAGGGATGGTAGTGGG + Intergenic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
912237699 1:107869673-107869695 CTGTGGGAACAGGTGGTATTTGG + Intronic
915591124 1:156871127-156871149 CTGTGTACAAATTTGGTACTTGG + Intronic
917224581 1:172767964-172767986 CACTGTGAAGAGATGGTATTAGG - Intergenic
917380592 1:174401999-174402021 AAGTGAGCAAAGATGGTATCTGG + Intronic
918702480 1:187622229-187622251 CTGTGTGCAAAGAAGCTATGAGG + Intergenic
919956566 1:202423029-202423051 CTGTGTGTATGCATGGTATTGGG + Intronic
920018563 1:202935200-202935222 ATATGTGCAAAGATTTTATTAGG - Intergenic
920060713 1:203225214-203225236 CTATGTGCAGAGACTGTATTAGG + Intronic
1065544174 10:26801984-26802006 CTGTCAGCAAACATGCTATTAGG - Intronic
1066683923 10:37962498-37962520 CTGTGTTCAGAGAATGTATTTGG - Intronic
1068446064 10:57125308-57125330 CTGTGTGATAACATGGTATAAGG - Intergenic
1069583283 10:69579380-69579402 CTGGGGGCAATGATGGTAGTGGG + Intergenic
1070617481 10:77979900-77979922 CTGTCAGCACAGATGGTTTTTGG - Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1072472602 10:95726815-95726837 CAGTGTGCAGAGATGATACTGGG - Intronic
1074810178 10:117096753-117096775 TTGTGTACAAAGATGTTAATTGG + Intronic
1075416220 10:122266482-122266504 CTGAGTGTCAAGATTGTATTGGG - Intergenic
1076017820 10:127042517-127042539 CTGGGGGCAAAGTGGGTATTTGG + Intronic
1076169683 10:128308938-128308960 CAGTGTGCAGAGGTGGTAGTTGG + Intergenic
1079766567 11:24400911-24400933 AGCTGTGCAGAGATGGTATTTGG + Intergenic
1079943567 11:26713101-26713123 GAGTGGGCACAGATGGTATTAGG - Intronic
1080331319 11:31142903-31142925 CTGTGGGCAAGGAGGGTATTGGG + Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1081119303 11:39245722-39245744 CTGTCCACAAAGATGGTTTTAGG - Intergenic
1082249236 11:49960975-49960997 CTGTCAGCAGAGATTGTATTGGG - Intergenic
1084642427 11:70433896-70433918 GTGTGTGCAGAGATGGAATCCGG - Intronic
1087877776 11:103378211-103378233 CTGTGTGAAAGGAAGGGATTTGG - Intronic
1087960634 11:104344143-104344165 CTGTGTTCAAAGAATGTATGAGG + Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1090075597 11:123578379-123578401 ATGCATGCAAAGAAGGTATTTGG - Intronic
1090722596 11:129490063-129490085 CTCTGTGCCAAGATAGGATTAGG - Intergenic
1098081184 12:66787122-66787144 GTGTGTGCACAGATAGTAATTGG - Intronic
1098521323 12:71437982-71438004 ATGTGGGAAAATATGGTATTTGG - Intronic
1099790587 12:87329600-87329622 AAGTGTGCAGAAATGGTATTTGG + Intergenic
1101975941 12:109359034-109359056 TTGTTAGCAAAGATGGTTTTCGG + Intronic
1102782417 12:115576573-115576595 GTGTGTGGAAAGCTTGTATTTGG - Intergenic
1104627303 12:130368309-130368331 CTGTGTGCAAAGTTGACATGTGG + Intronic
1105359840 13:19699738-19699760 CTGTGTTCATAGATGTTTTTAGG - Intronic
1106883358 13:34156366-34156388 CTGCGTGCAGACATGGTGTTTGG - Intergenic
1107213200 13:37883840-37883862 CAGTGTGGAAAAATGGTGTTGGG - Intergenic
1109232835 13:59780072-59780094 CTGTGTGCCAGGATGTTACTAGG + Intronic
1109232843 13:59780127-59780149 CTGTGTGCCAGGATGTTACTAGG + Intronic
1109272454 13:60269464-60269486 TTGGGTGTAAAGTTGGTATTCGG + Intergenic
1111755439 13:92388896-92388918 CTGTGTTCAAAAATGGTTATGGG + Intronic
1111761683 13:92474270-92474292 CTGTTTGCATAGATTGTAATAGG + Intronic
1113522825 13:110952876-110952898 CTGTGTGTACAGATGGCCTTAGG - Intergenic
1113702549 13:112397961-112397983 CTGTGTGTACAGATGGCCTTAGG + Intronic
1114793913 14:25690402-25690424 CTGTGTCAAAAGATGGTGTTAGG + Intergenic
1119484879 14:74980795-74980817 CTGTGTGCGCTGATGGGATTAGG - Intergenic
1121655969 14:95595920-95595942 GTGTGTGCAAGGATTGTATTAGG + Intergenic
1121909174 14:97773572-97773594 CAGTGTGCAAAGCTGAGATTTGG + Intergenic
1126957533 15:53950827-53950849 CTGTGTTCAAAGAGGGTTTCAGG + Intergenic
1127218253 15:56848065-56848087 TTGAGTGAAAGGATGGTATTTGG + Intronic
1127567432 15:60205586-60205608 GTATATACAAAGATGGTATTTGG - Intergenic
1132183734 15:99784106-99784128 CTGTTTGCATAGATTGTAATAGG - Intergenic
1132434649 15:101789064-101789086 CTGTTTGCATAGATTGTAATAGG + Intergenic
1139064745 16:63298859-63298881 CTGTGTGCAGAGATAGCATTTGG - Intergenic
1141525497 16:84608526-84608548 CTGTGGGCAAAGAAGGCAATGGG + Intronic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1144510671 17:15872438-15872460 CTGTGAAAAATGATGGTATTTGG + Intergenic
1145070366 17:19800438-19800460 TTGTGTGCAAGGATGAGATTTGG + Intronic
1145174827 17:20690161-20690183 CTGTGAAAAATGATGGTATTTGG + Intergenic
1146453305 17:32991387-32991409 GTGTGTGCAGGGATGGTAGTGGG - Intronic
1146453314 17:32991427-32991449 GCGTGTGCAAGGATGGTAGTGGG - Intronic
1146579643 17:34025331-34025353 CTGTGTGCCAAAATGGTGCTGGG + Intronic
1146985532 17:37213138-37213160 GTGTGTGTAAAGATGGATTTTGG - Intronic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1151979928 17:77502741-77502763 CTGTGTGCAAGGATGGAAATTGG - Intergenic
1156725581 18:40122349-40122371 CTGTGTGAAACGATGATATTGGG + Intergenic
1159894902 18:73987333-73987355 CTTTTTGCAAAGGTGGTTTTGGG - Intergenic
1163174446 19:15554373-15554395 GTGTGAGCAAAGATGGGACTAGG + Intergenic
1163373708 19:16916904-16916926 CAGTGTGCATAGCTGGTAATGGG - Intronic
1163819492 19:19487861-19487883 CTGTGTGCAAGGGTGGGATGAGG - Intronic
1167673292 19:50868807-50868829 CTGAGTGCTAAGAAAGTATTAGG + Intronic
1168518266 19:57026811-57026833 CTGTGTGCTAGGATGGAATTTGG - Intergenic
930776217 2:55173366-55173388 TTGTGTGCAAAACAGGTATTCGG + Intergenic
933126546 2:78615305-78615327 CTGTGTCCAGAGATGCTCTTTGG + Intergenic
934570023 2:95364403-95364425 CTGTGTTCAAAAGTGGCATTAGG + Intronic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
937256238 2:120557822-120557844 CTCTGTGCAAGTATAGTATTAGG - Intergenic
938610535 2:132943515-132943537 CTGTGTGTAAAGAGGGGTTTGGG - Intronic
939844688 2:147228969-147228991 ATGTTTGCAAAGATGGTTTCAGG - Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
940995380 2:160143920-160143942 CTGTGTGGAAAAATGGGTTTTGG + Intronic
941050901 2:160732709-160732731 CTTTGTACAAACATTGTATTGGG + Intergenic
942197536 2:173536588-173536610 CTGAGAGCAAAGAGGGAATTTGG - Intergenic
942489804 2:176477730-176477752 TTGTTTGCAAACATGTTATTTGG - Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
943728536 2:191277238-191277260 CTGTGTGCAAGTATTGTAGTGGG + Intronic
944901273 2:204219175-204219197 TTGCATGCAAAGATAGTATTAGG - Intergenic
947317545 2:228877892-228877914 CAGCATGTAAAGATGGTATTTGG - Intronic
947912846 2:233812826-233812848 CTTGGTGCAAAGTTGGCATTTGG + Intronic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1172669427 20:36624680-36624702 CTGTGAGCACAGATGGTGTTGGG + Intronic
1172760293 20:37316649-37316671 CTGTGAGCATAGACTGTATTAGG + Exonic
1173701254 20:45073825-45073847 GTGTGTGTAAAGATGGCAATGGG - Intronic
1174317017 20:49711544-49711566 GGGTGTGAAAAGATGGGATTTGG - Intronic
1174512899 20:51068462-51068484 CTGTCTGAAAATATAGTATTTGG + Intergenic
1174675177 20:52346891-52346913 CTTTGTGGAAAGATGCTTTTTGG + Intergenic
1177888943 21:26781598-26781620 CTGTGTCCAGAGTTTGTATTAGG + Intergenic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1181789938 22:25257260-25257282 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1181824733 22:25505951-25505973 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1183606211 22:38867953-38867975 CTCTGTGCCAAGATGGTCTGGGG + Intronic
1184858411 22:47159204-47159226 CTGTGTGCATACATGGTGTATGG - Intronic
949607501 3:5670386-5670408 CTGCATGTAAAGATGGTTTTTGG - Intergenic
950314237 3:11986470-11986492 CAGTGTGCAAAGATGCTATTAGG - Intergenic
952076584 3:29704197-29704219 CTGTGTGGGGAGATGGTTTTGGG - Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
955115757 3:55999076-55999098 TTGTATGCAGAGATGGTATCGGG - Intronic
955226625 3:57065658-57065680 CTGTATGAGAACATGGTATTTGG - Intronic
958594205 3:96201124-96201146 CTGAGTGCTTAGATGGTAGTTGG - Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962311042 3:134327146-134327168 CTGTTTGCAAAGCAGATATTTGG - Intergenic
963084617 3:141425496-141425518 CTATGTACAAAGATGCTATATGG - Intronic
965707218 3:171521270-171521292 ATGTGTGCTTAGATTGTATTAGG - Intergenic
969308772 4:6340211-6340233 TTGTGTGCAAAGATGGGTTAAGG - Intronic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972394483 4:38647001-38647023 CTGTGTTCTAATTTGGTATTTGG - Intergenic
974129176 4:57731531-57731553 CTGTGTGCAAAGAGGTTGTTTGG - Intergenic
977263251 4:94823427-94823449 CTGGGGGCAAAGCTGGTGTTCGG + Intronic
979339805 4:119509155-119509177 TTTTGTGAAAAAATGGTATTGGG + Intronic
980002350 4:127505465-127505487 CTGTGTGTCAAGATAATATTGGG + Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
981510458 4:145551312-145551334 CTGTTTGCATATATGGTATGAGG - Intronic
981870978 4:149486249-149486271 GTGTGTCCAGAGATGTTATTTGG + Intergenic
982091964 4:151888071-151888093 CTGTGGGAAAAGAAGCTATTCGG - Intergenic
984097731 4:175452433-175452455 CTGTGTGCAAAGTAAGTTTTAGG + Intergenic
984676043 4:182548741-182548763 CTGAGTGCAAAGACAGTCTTGGG + Intronic
985082046 4:186276251-186276273 CTGTCTGCAAACACCGTATTAGG - Exonic
986345111 5:6827443-6827465 CTGTGTGCACAGATTTGATTAGG - Intergenic
987300657 5:16595054-16595076 CCATGTGCAAAGATGGTATTTGG + Intronic
987564951 5:19572744-19572766 CAGTGTGATATGATGGTATTTGG - Intronic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
988078802 5:26389032-26389054 CTGTGTGCCAAGAAAGAATTAGG - Intergenic
988447830 5:31307840-31307862 CAGTGGGTAAAAATGGTATTTGG - Intronic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
995003988 5:107168901-107168923 TTGTGTGGATAGATGCTATTTGG - Intergenic
995996458 5:118306446-118306468 CACTGTGCAAAAATGGCATTTGG - Intergenic
999193684 5:149767456-149767478 CTGTGTGGAGAGATGGCATTAGG + Intronic
999582488 5:153054898-153054920 CTGTGAACAAAGAAGGTATTTGG - Intergenic
999969175 5:156841866-156841888 CTGTGTGCTAGGTTGGTATCAGG - Intergenic
1003417068 6:5919221-5919243 AAGTGTGCAAAGATTTTATTAGG - Intergenic
1003649164 6:7942821-7942843 CTGGCTGCAGACATGGTATTGGG - Intronic
1004615400 6:17283122-17283144 CTGTGTGCAAAAATGGATCTTGG + Intronic
1004828502 6:19450569-19450591 CTGTGTGCAAAGGTTCTATATGG + Intergenic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1006936251 6:37720572-37720594 CTGTCTGCAAAGATGGGATGGGG + Intergenic
1007177715 6:39908156-39908178 CAGTGGGCAAAGATGGTCCTTGG + Intronic
1007244740 6:40452763-40452785 CTGTGTGCTAAGGAAGTATTGGG - Intronic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1008962764 6:57282652-57282674 CTTTATGCAAAGAGGATATTAGG + Intergenic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1011722210 6:90169084-90169106 CTGTGTGCCAAGATGCTCTGGGG - Intronic
1014576687 6:123082353-123082375 CTGTGTGCAAACTAGGGATTTGG - Intergenic
1014581116 6:123138203-123138225 CTGTGTGCAAACTTGGGACTTGG + Intergenic
1015286728 6:131493673-131493695 CTGTCTGCAAAGGTGGGAGTTGG + Intergenic
1016323789 6:142876843-142876865 GTGTGTGTGAAGATGGGATTTGG - Intronic
1020521882 7:9200599-9200621 CTGTGGGCAAAGTTGCTATCGGG - Intergenic
1022794928 7:33724461-33724483 CTGGGTGACAAGATGGGATTGGG + Intergenic
1022813956 7:33895975-33895997 CCATGTGCAAAGATCGTGTTTGG - Intergenic
1023042172 7:36181310-36181332 CAGTGTGCACAGATGCTGTTGGG + Intronic
1023708788 7:42969920-42969942 GAGTGTGAAAAGATGGTATGGGG - Intergenic
1024527758 7:50363140-50363162 CTGGGGGAAAAGATGGGATTTGG + Intronic
1024683312 7:51717282-51717304 CTTTGTGCAAAGATGTTAGGGGG + Intergenic
1024825586 7:53386300-53386322 TTGTGTGCAAAGATGGGAAAGGG - Intergenic
1025613309 7:63096772-63096794 CTGTTTTCAGAGATGGTCTTTGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1029796047 7:102895608-102895630 CTGTGTGCAACGATGGGTTATGG - Intronic
1030243637 7:107358553-107358575 CTGATTGCAAGGTTGGTATTTGG + Intronic
1035632007 8:1115043-1115065 CTGTGGTCCAAGATTGTATTTGG + Intergenic
1036174683 8:6525875-6525897 ATATTTGCAAAGATGATATTTGG + Intronic
1036439026 8:8763693-8763715 GTGTGTCCATACATGGTATTAGG - Intergenic
1036691249 8:10946176-10946198 CTGTGTGCAAATAGGCTACTTGG - Intronic
1037257656 8:16973244-16973266 CTGTTTGAAATAATGGTATTGGG - Intergenic
1039479081 8:37858462-37858484 ATGTGTGAATAGAGGGTATTAGG - Intergenic
1039949304 8:42155470-42155492 CTGCTTGCAAAGATGAGATTGGG + Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1040728962 8:50419373-50419395 CTGTCTGCCAAGGTGGTATTAGG + Intronic
1041603707 8:59754666-59754688 GTGTACGCAAAGAGGGTATTAGG + Intergenic
1043194870 8:77279360-77279382 ATGAATGCAGAGATGGTATTTGG - Intergenic
1044636863 8:94334149-94334171 CTCTGAGCAGAGATGGGATTTGG + Intergenic
1044735540 8:95274639-95274661 CTAGGTTCAAAGTTGGTATTTGG + Intergenic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1047921649 8:129640630-129640652 CTATCTCTAAAGATGGTATTAGG + Intergenic
1048659716 8:136584795-136584817 TAGTGTGTAAAGGTGGTATTAGG - Intergenic
1048826689 8:138434588-138434610 CAGTGTAAAAATATGGTATTAGG + Intronic
1050023298 9:1307484-1307506 CTGTGTGCAAAAAAGGTGCTCGG + Intergenic
1050132166 9:2424218-2424240 TTGTGTGCAAACATGTTACTTGG - Intergenic
1052154980 9:25175380-25175402 CTGTGTGGATTGATGGTAGTAGG - Intergenic
1053582556 9:39421432-39421454 CTGTCTGTAAAAATGCTATTAGG + Intergenic
1053846737 9:42246283-42246305 CTGTCTGTAAAAATGCTATTAGG + Intergenic
1054104135 9:60980173-60980195 CTGTCTGTAAAAATGCTATTAGG + Intergenic
1054582213 9:66926673-66926695 CTGTCTGTAAAAATGCTATTAGG - Intronic
1056187832 9:84153907-84153929 CTGTTTGCAAAGTTGGTCCTTGG + Intergenic
1056901811 9:90606983-90607005 ATTTTTGCAAAGATGGTTTTAGG + Intergenic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1058151224 9:101465618-101465640 CTATGTGCATAAATTGTATTTGG + Intergenic
1058801733 9:108551216-108551238 CTGTGAGCAAAAATGGGATATGG - Intergenic
1062122398 9:134840883-134840905 CCGTTCCCAAAGATGGTATTAGG - Intronic
1186987596 X:15033578-15033600 GGGTGTGTAAAGATGGTATGGGG - Intergenic
1187286640 X:17911307-17911329 CTATGGTCAAAGATGGTATCTGG + Intergenic
1190209428 X:48433110-48433132 CTGTGGGGAAAGATGGTGTGGGG - Intergenic
1191779280 X:64848777-64848799 CTGTTTGCCAAGATAGTTTTTGG + Intergenic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1192604350 X:72499427-72499449 CTGTGTCCCAAGAGTGTATTTGG - Intronic
1196946652 X:120833233-120833255 CTGTGGGAAAAGATAGTATCTGG + Intergenic
1197138107 X:123086296-123086318 CACTGTGCAAACATGATATTAGG - Intergenic
1198676600 X:139137929-139137951 CTGTCTGCAAAGATGATGATTGG - Intronic
1200411763 Y:2868283-2868305 CAGAGTGCAGAGATGGTATTGGG + Intronic