ID: 1192117722

View in Genome Browser
Species Human (GRCh38)
Location X:68427493-68427515
Sequence GGCTTTACAAAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192117722_1192117734 14 Left 1192117722 X:68427493-68427515 CCCAGCCCCATCTTTGTAAAGCC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1192117734 X:68427530-68427552 CCCAGTGAAATCGCTTATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1192117722_1192117729 -10 Left 1192117722 X:68427493-68427515 CCCAGCCCCATCTTTGTAAAGCC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1192117729 X:68427506-68427528 TTGTAAAGCCACAGACCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192117722 Original CRISPR GGCTTTACAAAGATGGGGCT GGG (reversed) Intronic
902536908 1:17124445-17124467 GGCTTTCCATGGATGGGGGTGGG + Intergenic
903994418 1:27296817-27296839 GGCATTACTCAGCTGGGGCTGGG - Intronic
905533288 1:38699347-38699369 TGGTTAGCAAAGATGGGGCTGGG - Intergenic
906141664 1:43537239-43537261 GGCTCTAGAAGGAAGGGGCTGGG + Intronic
906561798 1:46763697-46763719 GGCTTTACACAGAGGGAGCCTGG - Intronic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907167894 1:52431117-52431139 GGCTGTGCAAAGATGATGCTGGG + Exonic
912243745 1:107939303-107939325 GCCTTTACACAGATGGTCCTAGG + Intronic
914918857 1:151834241-151834263 GGCCCTCCAAGGATGGGGCTGGG - Intergenic
915364685 1:155308366-155308388 GGCTTAAGAAAGATGAGTCTTGG - Intergenic
920711424 1:208298934-208298956 TGCTTAAGAGAGATGGGGCTGGG + Intergenic
924062507 1:240189607-240189629 TGCTTTTCAAAAATGCGGCTAGG + Intronic
924739170 1:246784886-246784908 AGCTTTACAAAAATCGGTCTCGG + Intergenic
1064670277 10:17706677-17706699 AGCTTTAAAAATATGGGCCTCGG - Intronic
1065768051 10:29050315-29050337 TTCTTTACAAAGATGGGGGCAGG - Intergenic
1066048037 10:31611558-31611580 AGCCTAACAAAGATGGGTCTCGG - Intergenic
1072657895 10:97343350-97343372 GGATTTAAAAATGTGGGGCTGGG + Intergenic
1075211938 10:120498944-120498966 GGCTTTGCAGAGATGGGGAAAGG + Intronic
1076858363 10:133128205-133128227 GGCTTTGCACAGCTGCGGCTTGG - Intronic
1077475664 11:2789133-2789155 GTCTTTCCAAAGAAGGTGCTGGG - Intronic
1077532915 11:3105695-3105717 GGCTTCACAGAGGTGGGGCAGGG - Intronic
1079364614 11:19798468-19798490 GGCTTTAAAAAGATGTGGGGAGG + Intronic
1085196921 11:74678339-74678361 GGCTGTGCCAGGATGGGGCTTGG + Intergenic
1088357558 11:108959823-108959845 GGCTTCACACAGATAGTGCTTGG - Intergenic
1089001132 11:115053410-115053432 GTATTAACAAACATGGGGCTGGG - Intergenic
1089167333 11:116487278-116487300 GGCTGAACAAAGATGTGGCTGGG - Intergenic
1089551138 11:119279202-119279224 GGCATTAGAAGGTTGGGGCTGGG + Intronic
1092148991 12:6234038-6234060 GGATTTGAAAAGGTGGGGCTGGG + Intronic
1095053905 12:37578320-37578342 AGTTTTACAAAGATGGAGCCTGG - Intergenic
1098100089 12:67006025-67006047 GGCTTTTCAAAGGTGAGGATTGG + Intergenic
1102015112 12:109643128-109643150 GGCTTTTCACAGAGGGAGCTGGG - Intergenic
1102569120 12:113816643-113816665 GGCTTGTCTAGGATGGGGCTTGG + Intergenic
1102803532 12:115758963-115758985 GGATTTTCAGAGAAGGGGCTGGG + Intergenic
1103679608 12:122682840-122682862 TGTTTTAGAAAGATGGAGCTGGG + Intergenic
1105590785 13:21791080-21791102 GGATGTCCAAAGATGGGGCATGG - Intergenic
1106053018 13:26209173-26209195 GGCATTTCAATGTTGGGGCTTGG - Intronic
1106164312 13:27229311-27229333 GTCTTTTCAAAAATGGTGCTGGG - Intergenic
1109794130 13:67287671-67287693 GGTTTCACTAACATGGGGCTTGG - Intergenic
1110314989 13:74095830-74095852 GGCTCAACAAATTTGGGGCTAGG - Intronic
1111012259 13:82327820-82327842 GGTTTGACAAAGCTGGGCCTGGG - Intergenic
1114947613 14:27704768-27704790 GACTTAACAAAGAGGTGGCTGGG + Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1123866946 15:24530202-24530224 GGCTACAGAAAGTTGGGGCTTGG - Intergenic
1125455582 15:39855594-39855616 GCCTTTATAATGCTGGGGCTTGG - Intronic
1128134089 15:65249837-65249859 GGGTCTGCAATGATGGGGCTGGG + Intronic
1129758480 15:78112788-78112810 GGCTTGATAAAGGTGGGCCTGGG - Intronic
1132750892 16:1457130-1457152 GGCTGTCCTCAGATGGGGCTGGG + Intronic
1136076238 16:27819386-27819408 GGGTTGTCAAAGATGGGGATGGG - Intronic
1138458906 16:57136483-57136505 GCCTTTCCAGAGAAGGGGCTTGG - Intronic
1141876312 16:86827097-86827119 GCCTCTCCAAGGATGGGGCTGGG - Intergenic
1141909544 16:87049250-87049272 GGCTTTTCAAACAAGAGGCTCGG + Intergenic
1143917091 17:10302069-10302091 GGCCTTAGACAGATGGTGCTGGG - Intronic
1144710409 17:17398110-17398132 GTCTTTGCAAGGATGGGCCTGGG + Intergenic
1146629032 17:34456977-34456999 GGCTTTAAACAGAGGGGTCTTGG - Intergenic
1148774672 17:50088651-50088673 TGGTTTACAGAGATGGGGCCTGG - Intronic
1149010164 17:51848006-51848028 GGCTTTACAGAGCCAGGGCTAGG + Intronic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1149775551 17:59354127-59354149 TGCTTTCTAAAGTTGGGGCTGGG + Intronic
1151633824 17:75330080-75330102 GTCTTTAAAAAGATGGGCTTTGG + Intronic
1151834420 17:76573630-76573652 GGCTTAAAAAAGACTGGGCTGGG + Intronic
1154408116 18:14115297-14115319 GGCTATCCAAAGATGGGGTTTGG + Intronic
1157528166 18:48400906-48400928 GGCCACACAAAGATGGGGCACGG - Intronic
1160060584 18:75525832-75525854 GGATTCAGAAAGATGGGGGTCGG - Intergenic
1160561095 18:79756098-79756120 GGCTGTGCAGAGATGCGGCTGGG - Exonic
1161261402 19:3339839-3339861 GGCTTTTCAAAGCTGTGGGTAGG + Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1162931640 19:13960569-13960591 CGCTGCACAAAGGTGGGGCTCGG + Exonic
1166733149 19:45069812-45069834 GGCTTTCCTAGGAAGGGGCTGGG + Intronic
1166798554 19:45442629-45442651 GGCTTTTCAAAGTTGAGGCAAGG + Intronic
1167096085 19:47375736-47375758 GGGTTTACCAAGGTGGGCCTTGG + Intronic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
927961130 2:27241268-27241290 GGATTTGGAAAGCTGGGGCTAGG + Intronic
928170902 2:29002515-29002537 GGCTGTACAGGGATGGGGATGGG - Exonic
929102687 2:38331751-38331773 GTCTTTCCAAAAATGGTGCTGGG + Intronic
929445847 2:42000580-42000602 GGCTTCAAAGAGATGGGGATGGG + Intergenic
931617458 2:64174605-64174627 TGCTTTCCCAAGATGGGGTTGGG - Intergenic
931903564 2:66819172-66819194 GTCTTTACAAAGCTGGGTCTTGG + Intergenic
934052212 2:88220392-88220414 GGCTTGTCCCAGATGGGGCTAGG - Intergenic
935193077 2:100793799-100793821 GGATTTGTAAGGATGGGGCTGGG - Intergenic
1172187703 20:33041587-33041609 GGCTGTACAGGGACGGGGCTGGG + Intronic
1172673822 20:36653340-36653362 GGCTATACAAAAAAGGGGGTGGG + Exonic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1174452692 20:50629616-50629638 GGCTTGGCACAGATGGGCCTGGG - Intronic
1181481301 22:23200865-23200887 GGCTTTTCAAAGGCTGGGCTGGG + Intronic
1185393712 22:50576419-50576441 GGCTTGAGAATAATGGGGCTGGG - Intronic
951709759 3:25576114-25576136 GGTTTCACAGGGATGGGGCTGGG + Intronic
951950049 3:28190094-28190116 TGCTTTCCAGAGATGGGACTGGG - Intergenic
953451054 3:43006654-43006676 AGCTTTACAATGATGTGCCTTGG + Intronic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
959016380 3:101138909-101138931 GGCTGGAGAAAGATGGGGCATGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
963380935 3:144529316-144529338 TGCTTTACAAAGATGGGCAAAGG + Intergenic
964020187 3:152000705-152000727 TGTTTTATAAAGATGGGGATAGG + Intergenic
964020418 3:152003663-152003685 TGTTTTATAAAGATGGGGATAGG - Intergenic
964349595 3:155789871-155789893 GGCTTTTCAAAAATGGTGCTGGG + Intronic
965993009 3:174844089-174844111 TGCTTTACAACATTGGGGCTGGG - Intronic
966120073 3:176511157-176511179 GGCTTGACAAAGCTGGGCCCTGG + Intergenic
968063884 3:195747563-195747585 GGCTTTAAAAACATGGGCCTGGG + Intronic
968172783 3:196523860-196523882 GGTTTTGCAAAGCTGGGCCTTGG - Intergenic
969956766 4:10898540-10898562 TTCTTTACAAAGATGGTGTTAGG + Intergenic
974969536 4:68807163-68807185 GTATTTACAAAGATGTGGTTTGG + Intergenic
976644988 4:87377991-87378013 GGCTATTAAAAGATGGAGCTGGG + Intronic
983412600 4:167419081-167419103 GGTTTTCCAAAGCTGGGCCTTGG - Intergenic
983431308 4:167655205-167655227 GGCATTACAAACATGTGGGTTGG - Intergenic
983646308 4:169995322-169995344 GCCTTTACAAAAAAGGGGGTGGG - Intronic
983823772 4:172231013-172231035 TGCTTTAAAAAGCTGGGGGTGGG - Intronic
985061853 4:186088157-186088179 GGATTTCCAAAGATGGACCTGGG + Intergenic
985776427 5:1846489-1846511 GGTTTCACAAAGAGGGGGCTGGG + Intergenic
986949367 5:13063061-13063083 GGCTTTTCAGAGGTGGTGCTGGG + Intergenic
990813485 5:59755044-59755066 GGTTGTACAAAGATGGTGTTTGG + Intronic
996442862 5:123511973-123511995 GGCTCTAGAAAGACGGGGATAGG + Intergenic
997617936 5:135265305-135265327 AGCTTTACTCAGAAGGGGCTGGG - Intronic
998462805 5:142322081-142322103 GGTTTACCAAAGTTGGGGCTGGG + Intronic
998899886 5:146842047-146842069 GGCTTCACAGTGATGTGGCTAGG - Intronic
1000465474 5:161570223-161570245 AGCTCTGCAAAAATGGGGCTGGG + Intronic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1005031414 6:21512406-21512428 TGGTTTACAAAGACGGAGCTGGG + Intergenic
1005345747 6:24888489-24888511 GGATTTCCAAAGATGTAGCTTGG - Intronic
1005389507 6:25318809-25318831 GGCTTTGAGGAGATGGGGCTGGG - Intronic
1005812924 6:29530223-29530245 GGCTCTTCCAAGATGGGTCTTGG - Intergenic
1007052746 6:38848893-38848915 GGCTTGACTATGATGGGGTTTGG + Intronic
1007130375 6:39466793-39466815 TGCCTTACAAAGAGGGGCCTGGG - Intronic
1007669659 6:43540771-43540793 AGCTTAAGAAAAATGGGGCTGGG - Intronic
1017129004 6:151092056-151092078 GGTTTTACAAAAATGTGTCTTGG + Intronic
1017160910 6:151365361-151365383 GCCTTTACAGAGGTGGGGCTGGG + Exonic
1017307029 6:152930422-152930444 GTCTTTACAACAATGGTGCTGGG + Intergenic
1018282918 6:162207070-162207092 AGCCTTAAAAAGATGGGGATCGG + Intronic
1018550205 6:164988709-164988731 GGCTTTAAAAAAATTGGGCTGGG + Intergenic
1019662838 7:2234598-2234620 GGCTTTAGAAGGCTGAGGCTGGG - Exonic
1020240063 7:6387438-6387460 GGCTTTTAAAAAATAGGGCTGGG + Intronic
1021482443 7:21132644-21132666 GGCATGAAAAGGATGGGGCTTGG + Intergenic
1022537929 7:31109518-31109540 GGCTTGAGAAAAGTGGGGCTGGG + Exonic
1026849719 7:73717260-73717282 GGCTGAACAGAGATGGTGCTGGG - Intronic
1028251461 7:88543701-88543723 GGTTTTGCAAAGCTGGGCCTTGG + Intergenic
1028798507 7:94932720-94932742 TCATTTACAAAGATGGTGCTGGG + Intronic
1034695389 7:153048699-153048721 GGCTTTCCAAAGAAGAGGCTGGG - Intergenic
1035634010 8:1129863-1129885 GGCTTTACAAATGTGGTCCTGGG - Intergenic
1036062501 8:5339740-5339762 GGCTTTACAGAGATATGGGTAGG + Intergenic
1039328051 8:36506342-36506364 GACTCTACAAAGCTGGAGCTGGG + Intergenic
1041825005 8:62085180-62085202 GGTTTCTCAAAGATTGGGCTTGG + Intergenic
1042944964 8:74145301-74145323 GGCTTTGCAAAAATGGGCCTGGG - Intergenic
1044008068 8:86961704-86961726 GGCCTTACAAAGATCGTGGTAGG - Intronic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1047219969 8:122911265-122911287 GGCTTTGCCAAGATGAGGGTGGG + Intronic
1048986074 8:139735777-139735799 GGTTGTACAGAGCTGGGGCTAGG - Intronic
1049341075 8:142112974-142112996 GGCTTTTCACAGCTGGTGCTGGG + Intergenic
1050421012 9:5465284-5465306 GGCTTTGAAAAGGTGGTGCTGGG - Intronic
1053418008 9:37958902-37958924 GGCTCTGCAAAGTAGGGGCTCGG - Intronic
1053425765 9:38008925-38008947 GGCACTACAGAGCTGGGGCTGGG + Intronic
1055230840 9:74063329-74063351 GGTTTTACAGAGATGGTGATAGG - Intergenic
1055720467 9:79167581-79167603 GGCTTTTAAATGATGGAGCTGGG + Intergenic
1057585767 9:96327378-96327400 GGTTTCACTAAGATGGAGCTGGG - Intronic
1057868557 9:98700826-98700848 GGCTTCAGGAAGATGGGGATAGG - Intronic
1057954425 9:99396347-99396369 GGCTTGACAACGATGGGGATGGG + Intergenic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1061390852 9:130316350-130316372 GGCTGGAGAAAGATGGGGGTGGG + Intronic
1186788746 X:12976373-12976395 GCCTTTCTAAAGATGGGGGTGGG - Intronic
1189417893 X:40831328-40831350 GGCTCTGCAATGATGGGGATGGG + Intergenic
1191104336 X:56763321-56763343 GGTTTCACACAGATGGGGGTGGG - Intergenic
1192117722 X:68427493-68427515 GGCTTTACAAAGATGGGGCTGGG - Intronic
1193952687 X:87820780-87820802 GGCTTTCCAAAGAAAGTGCTGGG - Intergenic
1194258333 X:91662781-91662803 GGCTTTGAAGATATGGGGCTTGG - Intergenic
1195303219 X:103552886-103552908 TGCTTTACAAAGAGGGGTTTGGG - Intergenic
1196117811 X:112016129-112016151 TTCTCTACAAAGATGGGGGTGGG + Intronic
1196670407 X:118360673-118360695 GCCTGTACAAAGAAGGCGCTAGG - Intronic
1197274778 X:124465540-124465562 GGCATAACTAAGATGGGGCACGG - Intronic
1197777128 X:130125750-130125772 GGCTTTAAACAGAAAGGGCTGGG - Intergenic
1198100610 X:133418856-133418878 TGATTTCCAAATATGGGGCTGGG + Intergenic
1198330740 X:135620031-135620053 GTCTTTACAAACATGGGACATGG + Intergenic
1198336184 X:135668962-135668984 GTCTTTACAAACATGGGACGTGG - Intergenic
1198816628 X:140598482-140598504 GGCTATAAGAAGATGGGGCCAGG - Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic