ID: 1192118265

View in Genome Browser
Species Human (GRCh38)
Location X:68432071-68432093
Sequence TCTCCTTCCCCCATTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192118265_1192118269 27 Left 1192118265 X:68432071-68432093 CCACACACAATGGGGGAAGGAGA 0: 1
1: 0
2: 4
3: 14
4: 266
Right 1192118269 X:68432121-68432143 AGCACTGGAAAAGCGAAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 166
1192118265_1192118268 12 Left 1192118265 X:68432071-68432093 CCACACACAATGGGGGAAGGAGA 0: 1
1: 0
2: 4
3: 14
4: 266
Right 1192118268 X:68432106-68432128 GCTGAGTCAGCTGTGAGCACTGG 0: 1
1: 1
2: 3
3: 27
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192118265 Original CRISPR TCTCCTTCCCCCATTGTGTG TGG (reversed) Intronic
900203839 1:1422697-1422719 CCTCCGTGCCCCACTGTGTGTGG - Intergenic
900559419 1:3296388-3296410 TCTCCTTCCTCCACTCTGTGCGG + Intronic
903788074 1:25874795-25874817 TCCCCTTCCCTCACTGTGTGTGG + Intergenic
904328916 1:29745346-29745368 TCTCCTTGGCCCAATGTCTGGGG - Intergenic
906430690 1:45753617-45753639 TGTCCTTCCCCTATTGACTGGGG + Intergenic
906878896 1:49567714-49567736 TCTCCCTCCCTCATTCTATGAGG + Intronic
907606004 1:55818138-55818160 TTACCTATCCCCATTGTGTGGGG + Intergenic
907615983 1:55927145-55927167 GCCCCTTGCCTCATTGTGTGAGG - Intergenic
907713785 1:56908951-56908973 CCTCCTTGCCCCACTGTGGGTGG - Intronic
908776937 1:67649585-67649607 TCCCCTTCCTCCATGATGTGCGG + Intergenic
909534963 1:76726307-76726329 CCTCTTTCCCCCATAGGGTGGGG - Intergenic
909926111 1:81439752-81439774 GTCCCTTGCCCCATTGTGTGAGG + Intronic
910579708 1:88809784-88809806 TTTCTTTCCCCCATAGTGTCAGG + Intronic
911120058 1:94287253-94287275 TCTCCCTCCCTCAATATGTGGGG - Intergenic
913168285 1:116209500-116209522 CCTCCTTCCCCCTTTCTCTGGGG + Intergenic
915105988 1:153535472-153535494 TCTCCTGATGCCATTGTGTGTGG - Intronic
915147397 1:153803117-153803139 TCCCCTGCCGCCATTTTGTGGGG - Intergenic
919325821 1:196105521-196105543 TCGCCTTCCGCCATGATGTGAGG + Intergenic
920967200 1:210711166-210711188 TCTCCTTCCCCCATGGTCTGGGG - Intronic
923045501 1:230352793-230352815 TCCCATTCTCCCACTGTGTGGGG - Intronic
923936397 1:238765118-238765140 TATCTTTCCCCCATTGGCTGGGG + Intergenic
1066230701 10:33429975-33429997 TCTCCTTCCCCCCTAGTCTTAGG - Intergenic
1066539508 10:36430241-36430263 TTTCCTTCCCACAATGTCTGTGG + Intergenic
1068708809 10:60108884-60108906 TCTCCTTCCACCATGGGGGGTGG + Exonic
1070692295 10:78536332-78536354 ACCCCTACCCCCATTTTGTGGGG + Intergenic
1071758163 10:88569419-88569441 TCTCCTTCATCCAGTGTGTCTGG - Intronic
1073540380 10:104312780-104312802 TCTCCTTCCTTCAGTTTGTGGGG + Exonic
1073775637 10:106782750-106782772 TCTGCTTCCACCATTGTGAATGG + Intronic
1075698881 10:124455675-124455697 ACTCCTTCCCACATTGTTTCTGG + Intergenic
1076739775 10:132477481-132477503 CCTGCTTCCCCCATTGGTTGGGG + Intergenic
1076862251 10:133143735-133143757 TCTCTCTCCCCCACTGTGGGCGG + Intergenic
1077210266 11:1367862-1367884 TCTCCATCTCCCAGTGTGGGGGG - Intergenic
1078563945 11:12397790-12397812 TCCCCTGCCCCCATTTTCTGGGG + Intronic
1079160750 11:17991466-17991488 TCTCCATCCCTCATTGACTGTGG + Intronic
1079656534 11:22992847-22992869 TGTCCTTTCCCCATTGGTTGGGG + Intergenic
1079977556 11:27110584-27110606 TCTCCTTCCCTTATTTTGTTTGG + Intronic
1080782148 11:35439547-35439569 TCCCCTTCCCCACTTGTGTTTGG - Intronic
1081592734 11:44436144-44436166 CCTCCTTCCACCACTGTGTCTGG - Intergenic
1083373504 11:62201223-62201245 TCACCCTCCCCCATTTGGTGTGG - Intergenic
1084452492 11:69248071-69248093 GCTCCTTTCCCCATAGAGTGGGG - Intergenic
1084938801 11:72601386-72601408 CCTCCTTCCCCCAGCATGTGAGG + Intronic
1085026890 11:73241648-73241670 TCCTCTTCCCCCATGCTGTGAGG + Intergenic
1086454145 11:86944997-86945019 TCTCCTTCCCTCTGTATGTGAGG + Intronic
1086646625 11:89230264-89230286 TGTCCTTTCCCCATTGTTTTTGG - Intronic
1087614370 11:100471339-100471361 TATCCCTACCCCATGGTGTGTGG + Intergenic
1088072452 11:105806232-105806254 TCTCCTATTCCCATTATGTGGGG - Intronic
1088194994 11:107264413-107264435 TCTCCTTCCCCAACTGAGGGAGG + Intergenic
1088455640 11:110030375-110030397 ACTCCTTCTCCCAGGGTGTGAGG - Intergenic
1088706202 11:112466687-112466709 TCACCTTCCGCCATGATGTGAGG - Intergenic
1092259837 12:6946880-6946902 TCCCCTTCCCGCAAGGTGTGAGG + Intronic
1093061013 12:14603966-14603988 TCTCCCTAACCCATTCTGTGAGG - Intergenic
1093076316 12:14761869-14761891 TCACCTTCCACCATGATGTGAGG + Intergenic
1093706454 12:22279789-22279811 ACCCCTTTCCCCATTGTGTTGGG + Intronic
1094616912 12:32044222-32044244 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1095408890 12:41900449-41900471 TATCCCTTTCCCATTGTGTGTGG - Intergenic
1097268474 12:57759366-57759388 GCTCCATCCCCCATTGCATGGGG + Exonic
1097788167 12:63783994-63784016 ACTCCTGCCTCCCTTGTGTGAGG + Intronic
1098077715 12:66750559-66750581 CCTCCTTCACCCAGTGTGTGAGG - Intronic
1098247688 12:68537332-68537354 TCTCCATCCCCCACTGTCTGTGG - Intergenic
1098335230 12:69397586-69397608 TCACCTTCCACCATGATGTGAGG + Intergenic
1100101380 12:91109897-91109919 TCTCCCACCTCCATTCTGTGAGG - Intronic
1100326383 12:93543606-93543628 TCTCCAAGCCCCATTGTGTAGGG - Intergenic
1101270331 12:103136765-103136787 TGTCCTTTCCCCAATGTATGAGG - Intergenic
1102676469 12:114662912-114662934 TCCCCTCCCCCCATTCTGGGAGG + Intergenic
1103560366 12:121790294-121790316 GCCCCTTCCGCCACTGTGTGTGG + Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1105053628 12:133078209-133078231 TCTACTCCCAGCATTGTGTGGGG - Intergenic
1105828422 13:24143125-24143147 TCTCCATCCACCACTGGGTGAGG + Intronic
1105948634 13:25210528-25210550 TCTCCTTCCCCCTTTGTAACTGG + Intergenic
1107803991 13:44137139-44137161 TCCCCTTCCCACAGTGTATGTGG + Intergenic
1108040266 13:46333349-46333371 TCTCCTGCCCCCATGGTGTGAGG + Intergenic
1109704706 13:66074436-66074458 TCTCCTTTCCCCATTGCCAGAGG - Intergenic
1110183399 13:72644138-72644160 TCTCCTTACCTCATTATCTGAGG - Intergenic
1110398278 13:75058501-75058523 TCTCCTTAACCCATTCTATGAGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1112972783 13:105281477-105281499 TTTCCTTCCCCCATCATATGTGG + Intergenic
1114638893 14:24205915-24205937 TCTCCCTTCCCCATGGTGTTGGG - Exonic
1115344478 14:32327759-32327781 GCTACTTCTCCCCTTGTGTGTGG + Intergenic
1117651078 14:57905994-57906016 TCTCCTGCCCTCATGCTGTGCGG - Intronic
1121778385 14:96606073-96606095 TCCCCTCCCCTCATTGTGGGTGG + Intergenic
1122684790 14:103496785-103496807 TCACCTTCCCCCAAAGTGTCAGG - Intronic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1127473890 15:59314399-59314421 CCTCCTTCCCACATACTGTGAGG + Intronic
1127623422 15:60756250-60756272 TCACCCTCCACCATTGGGTGAGG + Intronic
1128131247 15:65228510-65228532 TCTCCTTCCTGCCTTCTGTGTGG - Intergenic
1128767592 15:70260659-70260681 TCTCCTTCCCTCACAGTGTCTGG - Intergenic
1128964720 15:72047216-72047238 TCTCCTTCCCACCTTGTGGGAGG - Intronic
1129642251 15:77392912-77392934 CCTCCCTCCCCCATCCTGTGTGG + Intronic
1130041746 15:80410864-80410886 TCTCTTTCCCTCCTTTTGTGGGG + Intronic
1131062526 15:89412705-89412727 TCCCCTTGCCCCTTTCTGTGGGG - Intergenic
1133831368 16:9326446-9326468 TCACCTTCCACCATGATGTGAGG - Intergenic
1133962268 16:10504871-10504893 TGTCCTTTCCCCATTGGCTGAGG - Intergenic
1136414927 16:30097010-30097032 TGTCCTTTCCCCATTGGCTGGGG - Intergenic
1136415956 16:30103977-30103999 TGTCCTTTCCCCATTGACTGGGG - Intergenic
1139185576 16:64802036-64802058 ACACCTTCACCCATTATGTGAGG + Intergenic
1139964177 16:70736482-70736504 TCTCCCTCCCCAGATGTGTGGGG - Intronic
1140121221 16:72084526-72084548 TGTCTTTCCCCCATTGGCTGGGG - Intronic
1140925847 16:79582822-79582844 TCTCCTTCCCTTCTTGTGGGTGG + Intergenic
1141403735 16:83773577-83773599 TCTCCCTCCCTCAATATGTGGGG + Intronic
1144941680 17:18946588-18946610 ATTCCTTCCCCCAGGGTGTGGGG + Intergenic
1146680066 17:34800690-34800712 ACTCCTGTCCCCATTGTTTGAGG + Intergenic
1147521594 17:41178384-41178406 TCTCCTTTCCCTAATGTGTTAGG + Intergenic
1150587598 17:66532686-66532708 TCTCCTTCCCTCTTTGCATGGGG + Intronic
1150596542 17:66610754-66610776 TGTCCTTCCCCTATTGATTGGGG + Intronic
1150647900 17:66991362-66991384 TCTCCTTCCTGTACTGTGTGAGG + Intronic
1152032019 17:77848741-77848763 CCTCCCTCCACCATTGTGGGAGG + Intergenic
1152596947 17:81242425-81242447 TGTCCTTCACCCTGTGTGTGAGG + Intergenic
1155105694 18:22663666-22663688 TGTCCTTTCCCCATTTTTTGAGG - Intergenic
1155533543 18:26792150-26792172 ATACCTTCCTCCATTGTGTGGGG + Intergenic
1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG + Intergenic
1157087304 18:44594225-44594247 CCTCCTTTCCCCATTGTTTATGG - Intergenic
1158130429 18:54146955-54146977 TGTCCTCCTCCCATTGAGTGAGG - Intergenic
1161424511 19:4195492-4195514 TCTCCTTCCACCCTTGGGGGTGG - Intronic
1161652676 19:5494989-5495011 CCCCCGTCCCCCATTGTGAGTGG - Intergenic
1162221196 19:9178161-9178183 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1162550599 19:11356297-11356319 TCTGTGACCCCCATTGTGTGCGG + Intronic
1162823235 19:13235986-13236008 TTTCTTTTCCCCATTGTGGGTGG - Intronic
1163057155 19:14728898-14728920 TGTCCTTCCCCCATGGGCTGGGG + Intronic
1163875849 19:19866802-19866824 TGTCCTTCCCCCATTGGCCGGGG + Intronic
1163908445 19:20168018-20168040 TGTCCTTCCCCTATTGGCTGGGG - Intronic
1166165076 19:40981838-40981860 TGTCCTTCCCACAACGTGTGGGG + Intergenic
1167742126 19:51330014-51330036 TCTCTGTCCCCCACTTTGTGTGG - Exonic
1168224702 19:54986256-54986278 TATGTTTCCCGCATTGTGTGAGG + Exonic
1168306430 19:55438498-55438520 TTCCCTTCCCCCTTTGTGTTGGG - Intronic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
930045631 2:47169261-47169283 TCTCCTTCCCAAATTGTCTCAGG - Intronic
932477222 2:72013794-72013816 TCTCCTCTCCCCCTTGTGTGGGG - Intergenic
933243359 2:79947809-79947831 TCTCCTTGCCCCTTTCTTTGGGG - Intronic
933657352 2:84900100-84900122 TCCCCTGCCTCCTTTGTGTGAGG + Intronic
934910500 2:98249547-98249569 TCTCCTTCCCCAATTTTGGGGGG - Intronic
936813872 2:116435541-116435563 TGTCCCTCCCACAATGTGTGTGG - Intergenic
936853325 2:116928341-116928363 TTTCCTACCCTCATTGAGTGTGG + Intergenic
938396357 2:130951820-130951842 TTCCCTTCCCCCTTTTTGTGTGG + Intronic
939221128 2:139302554-139302576 TCTCCATCAGTCATTGTGTGCGG + Intergenic
941580295 2:167289017-167289039 TATCCTTTCCCCATTCTGCGTGG + Intergenic
941625024 2:167822023-167822045 GCTGCTTCCTCCACTGTGTGGGG - Intergenic
942090105 2:172481626-172481648 TCTCCGTCTCCCCTTCTGTGGGG + Intronic
942177281 2:173346137-173346159 TGTCTTTCCCCCATTGGCTGGGG - Intergenic
943276597 2:185875940-185875962 TATCCTTACCCCATTGTGCCAGG + Intergenic
943732872 2:191321793-191321815 TCTCCTACCCCCTTTTTATGGGG + Intronic
943826599 2:192402274-192402296 TCTCTTTCCACCTCTGTGTGTGG - Intergenic
944615039 2:201451554-201451576 TTGGCTTCCCCAATTGTGTGGGG - Exonic
946351480 2:219157606-219157628 TCTCCTTCGCCCATTGTTGAAGG - Exonic
947008298 2:225537431-225537453 TCACCTTCTGCCATGGTGTGAGG - Intronic
948925490 2:241094161-241094183 TCCCTTTTCCCCATTGCGTGTGG + Exonic
1169122546 20:3106024-3106046 TCTCCTGCCCCCATGGGGGGGGG + Intergenic
1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG + Intronic
1170822471 20:19766088-19766110 TGTCCTTCCCTCATGGTGGGAGG + Intergenic
1170907406 20:20528507-20528529 TCTCCTTACCCCACTGTTTCTGG - Intronic
1171190448 20:23155391-23155413 TGTCTTTCCCCCATTGACTGGGG - Intergenic
1172189167 20:33051451-33051473 TTCCCTGCTCCCATTGTGTGAGG - Intergenic
1173017536 20:39239148-39239170 TCTCTTTCCCACATTCTATGAGG + Intergenic
1173191055 20:40875833-40875855 TCTCCTGACCCCATTTTGTCGGG + Intergenic
1173423027 20:42919318-42919340 TCTCCTTACTCCATTGAGTATGG + Intronic
1173672673 20:44809638-44809660 TCTCCTTCCCTCATGGGCTGGGG - Intronic
1174094993 20:48081474-48081496 TCTCCTTCCCCTAGTTTCTGTGG + Intergenic
1174343581 20:49913692-49913714 TCTCCTAGCCCCATTCGGTGTGG - Exonic
1174482152 20:50838890-50838912 TCTCCTTTCTCCATGGGGTGTGG - Intronic
1174716919 20:52768855-52768877 TTTCCTTCTGCCGTTGTGTGGGG - Intergenic
1175161211 20:57009279-57009301 TCTCTCTCCCCCACTCTGTGTGG + Intergenic
1175790475 20:61737339-61737361 TCTCCTCACCCCAAGGTGTGGGG - Intronic
1176688360 21:9875088-9875110 TGTCCTTCCCCCAACATGTGGGG + Intergenic
1177587387 21:23116086-23116108 TCTTCTGCCATCATTGTGTGAGG - Intergenic
1178751749 21:35311241-35311263 TCTCCCTGCCCCTTTGAGTGTGG - Intronic
1179008750 21:37536946-37536968 TGTCCTTCCCCCATTGGCTGGGG + Intergenic
1179069089 21:38054885-38054907 CCTCCATCCCCCATGGTGAGGGG + Intronic
1180233750 21:46443930-46443952 TGACCTTCCCCCACTGTGTGGGG - Exonic
1181490964 22:23260602-23260624 TCTCCTTCCCTGACTGTGTCAGG + Intronic
1182454365 22:30440348-30440370 CCTCCCTGCCCCAGTGTGTGGGG + Intergenic
1183290080 22:36995766-36995788 TCACCTTCCACCATGATGTGAGG + Intronic
949296916 3:2535461-2535483 TCTCCTTCAACCATCATGTGAGG + Intronic
949622048 3:5824396-5824418 TCTGTTTACCCCATCGTGTGAGG - Intergenic
950241137 3:11371136-11371158 TCTCCTCCCTCCATTCTCTGGGG + Intronic
950855566 3:16101503-16101525 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
952829881 3:37555801-37555823 TCTGTTTCCCCCATTGTATATGG - Intronic
952946584 3:38481873-38481895 TCTCCTTCCCTCTTTGTTTTTGG + Intronic
956330113 3:68097398-68097420 TTTCCTTCCCCATTTGTGTTTGG + Intronic
956442416 3:69293401-69293423 TCTCATTTCTCCAGTGTGTGAGG - Intronic
957484550 3:80841285-80841307 TCTCCTCACCCCTTTGTGAGTGG - Intergenic
960125174 3:113990739-113990761 TATACTTCCCCCATTTTATGAGG + Intronic
960706737 3:120489659-120489681 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
960707675 3:120495969-120495991 TGTCCTTCCCCTATTGGCTGAGG - Intergenic
961010724 3:123434007-123434029 CCTCCTTTCCCCATGGTGTCTGG - Intronic
961207695 3:125099260-125099282 TCTGCCTCCCCCGTGGTGTGTGG - Intronic
963708081 3:148713546-148713568 TCACCTTCCCCTCTTGTGAGAGG - Intronic
965323513 3:167274821-167274843 TGTCCTTCCCCCATGGGCTGGGG - Intronic
966469504 3:180273183-180273205 TCTCCTTCCACCATTGTCTTGGG + Intergenic
969097660 4:4745803-4745825 TCTCCTAGCCCCATTCTGAGAGG - Intergenic
969674049 4:8605179-8605201 TCTCCCTCCCCAGCTGTGTGTGG - Intronic
969916794 4:10499221-10499243 TCCCCTTTCCCCATTGGCTGGGG - Intronic
970062048 4:12045186-12045208 TCTTATTCCTCCATTGTGGGAGG + Intergenic
970273237 4:14368950-14368972 CCTCCTTCCTCCATTGAGTGGGG - Intergenic
973017530 4:45159708-45159730 TCACCCTCCCCCCTTGAGTGTGG - Intergenic
975911791 4:79275923-79275945 TCTCCTCCCCCTATTTTGTAAGG - Intronic
976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG + Exonic
977001630 4:91511905-91511927 TCTCCTTCCCCAGTGGTCTGTGG + Intronic
980104860 4:128577920-128577942 TCCCCTTTCCCCATTCTTTGGGG + Intergenic
980299736 4:130973102-130973124 ACCCCTTGCCTCATTGTGTGAGG - Intergenic
980351735 4:131692888-131692910 TGTCCTTCCCCCAGCATGTGGGG + Intergenic
981083045 4:140654217-140654239 TACCCTTTCCCCATTGTCTGGGG + Intronic
982245289 4:153344767-153344789 TCTTCTTCCTCCCTAGTGTGTGG + Intronic
985099983 4:186449128-186449150 TCAGCTTCCCCCTTTGTATGTGG + Intronic
985137514 4:186802027-186802049 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
985621226 5:957243-957265 TGGGCTTCCCCCATTGTCTGGGG - Intergenic
987515795 5:18906336-18906358 AATCCTTCCCCCATTTTGGGTGG + Intergenic
987661899 5:20888805-20888827 TCTCCATCCCCCATTCTCTTGGG + Intergenic
988761688 5:34316514-34316536 TCTCCATCCCCCATTCTCTTGGG - Intergenic
993827912 5:92715422-92715444 CCTACCTCCCCCAGTGTGTGAGG + Intergenic
994549516 5:101213131-101213153 TCCCCTTCCCACATTGAGGGTGG - Intergenic
994606046 5:101968121-101968143 TCTCCTTCTCTCATTTTTTGAGG + Intergenic
995175223 5:109168400-109168422 TCTCCATCCCCCAATCTCTGGGG + Intronic
995588533 5:113674291-113674313 TCTCCATCTCCCATGTTGTGTGG + Intergenic
998004627 5:138648868-138648890 TCTCCTTCCCCCACTGAAAGAGG + Intronic
998601858 5:143592726-143592748 TCTCCTTCCCACAGTGGGAGAGG + Intergenic
1002298752 5:178246054-178246076 TCTCCTTGCCCCCATGTCTGTGG - Intronic
1002950557 6:1806195-1806217 ACTCCTTCCTCCAATGTATGAGG - Intronic
1003243583 6:4365677-4365699 GCCCCTTCCCCCATGGTGTTTGG + Intergenic
1005574388 6:27178274-27178296 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
1008871564 6:56278434-56278456 TCTCATTCTCTCATTCTGTGTGG + Intronic
1008893469 6:56523798-56523820 TGTCCTTACCCCATCATGTGTGG + Intronic
1010131638 6:72500862-72500884 TCCCCTGCCCCCACTGTGAGTGG - Intergenic
1010556126 6:77281760-77281782 GCTCCTTGCCTTATTGTGTGGGG + Intergenic
1014288346 6:119529136-119529158 CCCCCTTCCTCCATTCTGTGGGG + Intergenic
1014488534 6:122032581-122032603 TCTACTTATCGCATTGTGTGTGG - Intergenic
1016006972 6:139099175-139099197 GCCCCTTGCCTCATTGTGTGGGG - Intergenic
1016268024 6:142255004-142255026 TGTCTTTCCACCATTGTGAGGGG - Intergenic
1018772784 6:166986581-166986603 ATTCCTTCCCCCAGTGTGTATGG + Intergenic
1021386352 7:20035582-20035604 GCCCCTTGCCTCATTGTGTGGGG + Intergenic
1021846652 7:24769544-24769566 TTCCCTCCCCCCATTATGTGGGG - Intergenic
1022792129 7:33699629-33699651 TCTGCTTCCGCCTGTGTGTGTGG - Intergenic
1022799412 7:33761506-33761528 TCTCCTCCCCCAACTGTCTGGGG + Intergenic
1024540344 7:50470802-50470824 TCTCCATCCCTCAGTGTGTGGGG - Intronic
1025776836 7:64568188-64568210 TCTCTGTCCCCCACTTTGTGTGG + Intergenic
1026586528 7:71660348-71660370 CCTCCTCCCTCCACTGTGTGAGG + Intronic
1027627153 7:80560450-80560472 TCTCCCTACCTCATTCTGTGAGG - Intronic
1029191835 7:98777485-98777507 TCTCCCTCCCCCATGGGGTTGGG + Intergenic
1031077403 7:117225985-117226007 TGACCTTCCCACATTCTGTGAGG - Intronic
1032638984 7:133743756-133743778 ACTCCTTCACACAATGTGTGTGG - Intronic
1032948589 7:136880884-136880906 TCTCCTTCCCCTTTTGAGTAAGG + Intronic
1035874219 8:3170014-3170036 TGTCCTTTCCCCATTGGCTGGGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036818079 8:11916869-11916891 TCTCCTCCCCCCATGCGGTGCGG + Intergenic
1037090937 8:14917687-14917709 TTTCCTTGCCCCATTATGAGTGG - Intronic
1037939457 8:22940868-22940890 TCTTCTTCCCTGTTTGTGTGCGG - Intronic
1037980234 8:23247865-23247887 TCTCCTTCCCTCACTGAGAGAGG - Intronic
1039436845 8:37565226-37565248 CCTCCCTCCACCATTGTTTGAGG + Intergenic
1039450381 8:37669338-37669360 TCTCCCTTCCCCAATCTGTGTGG + Intergenic
1040921950 8:52631029-52631051 TGTCCTTCCCCTATTGGCTGGGG + Intronic
1042306417 8:67338004-67338026 CTTCCTTCCTCCATTATGTGAGG + Intronic
1043297321 8:78682404-78682426 TCACCTTCCACCATGATGTGAGG - Intronic
1044470086 8:92556693-92556715 ACTCCTTCCCCTAATTTGTGTGG + Intergenic
1045061040 8:98411460-98411482 TCTTCTTCCCCTATAGAGTGTGG + Intronic
1046463120 8:114568851-114568873 TTGCCTTCCACCATGGTGTGAGG + Intergenic
1047602155 8:126436468-126436490 TCTCCATCACCCATTGGCTGTGG - Intergenic
1047714208 8:127580702-127580724 TCTCCTTCTCCCATTCCCTGTGG - Intergenic
1049341139 8:142113258-142113280 TCTCCCTCACCCAATGTCTGGGG - Intergenic
1050111949 9:2226427-2226449 TCTCCTTCCCACAATGAGTTTGG + Intergenic
1050806750 9:9690098-9690120 ACTCCTTCCCACATTGTATGGGG + Intronic
1052667678 9:31515885-31515907 CCTCCTTACCTCATTTTGTGAGG - Intergenic
1052696505 9:31885667-31885689 CCTCCTTACCTCATTTTGTGAGG - Intergenic
1053476509 9:38385746-38385768 TCTCTTTCTCACACTGTGTGAGG + Intergenic
1053780980 9:41606813-41606835 TGTCCTTCCCCCAACATGTGGGG - Intergenic
1054168923 9:61816970-61816992 TGTCCTTCCCCCAACATGTGGGG - Intergenic
1054668607 9:67763841-67763863 TGTCCTTCCCCCAACATGTGGGG + Intergenic
1054748837 9:68883886-68883908 TATCCTTTCCCCATTGTGTGTGG - Intronic
1055958044 9:81792756-81792778 TCTCAATCACCCACTGTGTGTGG - Intergenic
1056462378 9:86820473-86820495 TCTCCCTCCCACATTGTGTGTGG + Intergenic
1058628978 9:106966505-106966527 TCTCACTCCCACATTCTGTGAGG + Intronic
1058778360 9:108308556-108308578 TCTTATTCCCCCAAGGTGTGTGG - Intergenic
1059091380 9:111362406-111362428 TCTCCTTCCCCCAGTATCAGTGG + Intronic
1059712002 9:116877153-116877175 TGTCCTTCCCCTATTGGCTGGGG - Intronic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1061024742 9:128041174-128041196 ATTCCTTCCCCCAGGGTGTGAGG - Intergenic
1061829028 9:133278877-133278899 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
1189961264 X:46327065-46327087 CTTCCTTCCCCCTGTGTGTGTGG + Intergenic
1190399294 X:50015473-50015495 TCTCATTTCCATATTGTGTGGGG - Intronic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1192291393 X:69799400-69799422 TTACCTTCTCCCATTCTGTGGGG - Intronic
1193040012 X:76995618-76995640 TCTCCTTCTCTTATTGTGTCCGG + Intergenic
1195263142 X:103153692-103153714 TCTCCTGTCCCCAGTGAGTGTGG + Intergenic
1196307814 X:114125426-114125448 TCTCCTACTCTTATTGTGTGGGG + Intergenic
1197845487 X:130797607-130797629 TCTCCTTCCCCCATCATCTCAGG - Intronic
1200788510 Y:7279519-7279541 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1200802698 Y:7400849-7400871 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
1202114702 Y:21460271-21460293 TCTCCTAATCCCATTGTCTGTGG + Intergenic