ID: 1192118618

View in Genome Browser
Species Human (GRCh38)
Location X:68434014-68434036
Sequence GCGCACCTGCCCCTTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192118618_1192118626 -4 Left 1192118618 X:68434014-68434036 CCGGCCCCAAGGGGCAGGTGCGC No data
Right 1192118626 X:68434033-68434055 GCGCGGCGCTGGACTCTGCGGGG No data
1192118618_1192118627 -3 Left 1192118618 X:68434014-68434036 CCGGCCCCAAGGGGCAGGTGCGC No data
Right 1192118627 X:68434034-68434056 CGCGGCGCTGGACTCTGCGGGGG No data
1192118618_1192118624 -6 Left 1192118618 X:68434014-68434036 CCGGCCCCAAGGGGCAGGTGCGC No data
Right 1192118624 X:68434031-68434053 GTGCGCGGCGCTGGACTCTGCGG No data
1192118618_1192118625 -5 Left 1192118618 X:68434014-68434036 CCGGCCCCAAGGGGCAGGTGCGC No data
Right 1192118625 X:68434032-68434054 TGCGCGGCGCTGGACTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192118618 Original CRISPR GCGCACCTGCCCCTTGGGGC CGG (reversed) Intergenic