ID: 1192120022

View in Genome Browser
Species Human (GRCh38)
Location X:68446779-68446801
Sequence TTGCTGTTGTTGTTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192120020_1192120022 23 Left 1192120020 X:68446733-68446755 CCAGAAAAGTTTTTTTTTTTTTT 0: 3
1: 94
2: 1308
3: 15669
4: 49993
Right 1192120022 X:68446779-68446801 TTGCTGTTGTTGTTGAGACAGGG 0: 8
1: 211
2: 430
3: 1079
4: 5005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192120022 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG Intergenic
Too many off-targets to display for this crispr