ID: 1192127216

View in Genome Browser
Species Human (GRCh38)
Location X:68513181-68513203
Sequence GTGTAGTGAAGGAGTTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192127214_1192127216 -7 Left 1192127214 X:68513165-68513187 CCTCTCTGGTTTGTTTGTGTAGT 0: 1
1: 0
2: 1
3: 52
4: 465
Right 1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1192127213_1192127216 -3 Left 1192127213 X:68513161-68513183 CCTACCTCTCTGGTTTGTTTGTG 0: 1
1: 0
2: 2
3: 32
4: 353
Right 1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1192127212_1192127216 -2 Left 1192127212 X:68513160-68513182 CCCTACCTCTCTGGTTTGTTTGT 0: 1
1: 0
2: 3
3: 38
4: 456
Right 1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG 0: 1
1: 0
2: 1
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192127216 Original CRISPR GTGTAGTGAAGGAGTTGAAC TGG Intronic
905468377 1:38173269-38173291 GTGTAATGAAGGGGTTGGATTGG - Intergenic
906565911 1:46801008-46801030 GTCTAGTGCAGAAGTTGAATAGG - Intronic
910338252 1:86156812-86156834 GGGTAGGGAAGGAGATGAAGTGG + Intronic
910791359 1:91054487-91054509 GTGCTGTGAAGGAAATGAACAGG + Intergenic
911250492 1:95571072-95571094 ATGTAATGTAGGAGTTGAACTGG - Intergenic
913026895 1:114852977-114852999 GTAAAATGAAGGAGTTAAACTGG + Intergenic
915601019 1:156923512-156923534 GTGTAGGGAAGGAGTGGGAGTGG + Intronic
917362048 1:174187281-174187303 GTAGAGTGAAGGAAGTGAACAGG + Intronic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
919201136 1:194356813-194356835 GTGCTGTGAATGAGTTGGACTGG - Intergenic
919303957 1:195806181-195806203 GTGGTGTGAAGGAGAGGAACTGG + Intergenic
922043144 1:221916790-221916812 GTGTTATGAAGGAGCTGAAAGGG + Intergenic
922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG + Intronic
1066278247 10:33889545-33889567 GTGTATTGAAAGAGATAAACAGG + Intergenic
1067429862 10:46235978-46236000 GAGTACAGAAGGAGCTGAACAGG - Intergenic
1071849401 10:89553073-89553095 GTGTGGTGAAGGAGTAGAGACGG - Intronic
1077007877 11:367482-367504 GTGACGTGAAGGAGATGAGCTGG - Intergenic
1077891456 11:6421008-6421030 GTGTCTTGAAGGAGATGTACCGG + Intergenic
1078077374 11:8174189-8174211 GTGTAGTGAAGGTTTGGAAATGG + Intergenic
1078456751 11:11481712-11481734 GTGCACTGAAGGAGTAGAATGGG + Intronic
1079985032 11:27191157-27191179 GTGTAGTGAATGCATTGAAAGGG - Intergenic
1084530966 11:69727544-69727566 GTGCAGTGCAGCAGTTGGACAGG - Intergenic
1087418409 11:97888370-97888392 GTGAAATGAAGGAGTTTAATGGG - Intergenic
1088480082 11:110288407-110288429 GTGAAATGAGGAAGTTGAACTGG - Intronic
1090171180 11:124606090-124606112 GTCTAGTGAAGGTGTTGATTGGG - Intergenic
1090426705 11:126612030-126612052 GAGTTGTGAAGGAGATGCACAGG - Intronic
1091404841 12:202779-202801 CAGAAGTGAAGGAGCTGAACAGG + Exonic
1091871358 12:3893824-3893846 GTGTAGAGAAGGAGAGAAACGGG - Intergenic
1094734923 12:33223346-33223368 GGGGAATGAATGAGTTGAACTGG - Intergenic
1100859911 12:98793938-98793960 GTGAAGTGAAGGATTTGCTCTGG - Intronic
1101572866 12:105971163-105971185 GTGTTGTGGAGGAATTGGACGGG + Intergenic
1105549034 13:21375211-21375233 GTGTTGTGAATAAGTTGGACTGG - Exonic
1106046892 13:26151120-26151142 GTGTTGTTAAGTAGTTGCACTGG - Intronic
1106835421 13:33629129-33629151 ATGTAGAGGAGGAGTTGAACTGG - Intergenic
1109750325 13:66683561-66683583 ATGTAGTGAAGCACTTAAACAGG - Intronic
1109916140 13:68987538-68987560 GTGTTATGAATGAGTTGGACTGG + Intergenic
1115291512 14:31777995-31778017 CTCTAGTGAAGGAGCTGCACAGG - Intronic
1116238841 14:42314638-42314660 CTGTACAGCAGGAGTTGAACTGG + Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1118568759 14:67172047-67172069 GTGTAGTGCAGTAGTTGCACAGG - Intronic
1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG + Intergenic
1119960439 14:78849691-78849713 GTGGAGGGAAGGAGTGGAATTGG + Intronic
1120380209 14:83768116-83768138 ATTTGGTGAAGGAGTTGAACAGG + Intergenic
1124560887 15:30772101-30772123 ATGTAGTGTAGAAGTTGAAGAGG + Intronic
1126130384 15:45335305-45335327 GTACAGTGAAGGAGTTGAGTAGG + Intergenic
1127267482 15:57373934-57373956 GTGCAATGAGGGAGTGGAACTGG - Intergenic
1128131067 15:65227530-65227552 GTGCAGTGAAGGAGATAAAAAGG - Intergenic
1128185032 15:65637701-65637723 GTGCAGTGAAGGAAAAGAACAGG + Intronic
1130707326 15:86245693-86245715 GAGAAGTCAAGGAGTTGAAAAGG + Intronic
1131011292 15:89020334-89020356 GTAAAATGGAGGAGTTGAACTGG - Intergenic
1133703543 16:8331965-8331987 GTGCAGTGAGGGAGGTGAAGGGG - Intergenic
1135778227 16:25275825-25275847 GTGTAGGGAAGGGGGTGAATGGG + Intergenic
1138911185 16:61401147-61401169 GTGTACTGAAGGAGAAGATCTGG + Intergenic
1148251850 17:46088478-46088500 GAATAGGGAAGGAGTTGAATGGG - Intronic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1152210608 17:79001216-79001238 GAGTGCTGAGGGAGTTGAACAGG - Intronic
1156422283 18:36967793-36967815 GTGGAGTGGGTGAGTTGAACAGG + Intronic
1156832230 18:41505563-41505585 ATGTGGAGAAGGAGATGAACTGG - Intergenic
1158036150 18:53033165-53033187 GTGTAATGAAGGAACTCAACTGG + Intronic
1158827610 18:61241221-61241243 TTGTAATGAAGGAGTTAAAGAGG - Intergenic
1163447169 19:17353497-17353519 GTGGAGTGATGGAGGGGAACGGG - Intronic
1165087635 19:33362130-33362152 CTGTAGTGGAGGAGATGAAGGGG - Intergenic
1167450665 19:49566741-49566763 GTCAAGTGAAGGAGTGGAAGTGG - Intronic
925166148 2:1716841-1716863 GTGAAATGAAGGAGTGGAACTGG - Intronic
926156543 2:10457765-10457787 GTGTAATGATGGAATTTAACTGG + Intergenic
933196086 2:79391706-79391728 GTACAGTGATGGAGTTCAACAGG + Intronic
934979217 2:98826479-98826501 GTGTTCTGAAGGAAGTGAACGGG + Intronic
936273031 2:111066440-111066462 GTGTGGTGATGGAGATGATCTGG + Intronic
941325352 2:164107547-164107569 TTGTAGTGAAAGACTAGAACAGG - Intergenic
943807220 2:192137259-192137281 GTGAAGTGAAAGATTTTAACAGG + Intronic
945501322 2:210579012-210579034 GTAAATTGAAGGAGGTGAACTGG - Intronic
948705518 2:239789915-239789937 GGAAAGTGAAGGAGTGGAACAGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173179186 20:40789461-40789483 GTGTAGTGAAGGAAGGGAAGAGG + Intergenic
1173195129 20:40907987-40908009 TTGGAGTGTAGGAGTTGAGCAGG - Intergenic
1175553488 20:59831782-59831804 ATGTAGTGAGGGAGAGGAACCGG + Intronic
1175792165 20:61746525-61746547 GTGTGGGGAAGGAGTGGAAAAGG + Intronic
1178094922 21:29204490-29204512 GAGTAGTGAAGCAGCTGAAAGGG + Intronic
1178733520 21:35128473-35128495 TTCCAGTCAAGGAGTTGAACAGG + Intronic
1184706753 22:46219484-46219506 TTTGAGTGAAGGAGGTGAACGGG - Intronic
949844302 3:8354283-8354305 GTGCATTGAAGGAGTTTAATAGG + Intergenic
950197424 3:11018677-11018699 CCGTGGTGAAGGAGTTGTACAGG - Exonic
956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG + Intergenic
957145305 3:76415190-76415212 GTGAAGTGAAAAAGTTGCACTGG - Intronic
961392286 3:126559267-126559289 AGGCAGTGAAGGAGCTGAACTGG + Intergenic
961755999 3:129127769-129127791 GTGCACTGAAGGCGTGGAACAGG + Intronic
964690455 3:159443988-159444010 CTGTAGGGAAAGAGTAGAACTGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965805145 3:172534182-172534204 GGGGAGTGCATGAGTTGAACTGG - Intergenic
966489839 3:180516140-180516162 GGGGAATGAATGAGTTGAACTGG + Intergenic
967408310 3:189141832-189141854 GTGTAATGAAGGAAGAGAACAGG + Intronic
969897053 4:10315214-10315236 GTGTGCTGAGGGAGATGAACTGG + Intergenic
971879619 4:32353647-32353669 GTGTAGTGAAGGTATTTTACCGG - Intergenic
974713187 4:65630299-65630321 GAGAAGTGATGGAGTTTAACTGG + Intronic
975270536 4:72427189-72427211 GTGTTGAGAAAGAGTGGAACTGG - Intronic
975459923 4:74639450-74639472 GTGTATTGAAAGAGTCGATCTGG + Intergenic
976400681 4:84603321-84603343 CTGGAGTGAGGGTGTTGAACTGG - Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
977621632 4:99144602-99144624 GGGTTGTGAAGGAGAAGAACAGG - Intronic
980158360 4:129132880-129132902 GTATAGGTAAGGAGTTGACCTGG + Intergenic
981230035 4:142341948-142341970 CTATAGTCAAGGTGTTGAACGGG - Intronic
982239616 4:153285890-153285912 GTGTACTGAAGGTGCTGACCAGG - Intronic
982391481 4:154869034-154869056 CTACAGGGAAGGAGTTGAACAGG - Intergenic
983827559 4:172282641-172282663 GTGTGGAGAATGAGTTGAAATGG + Intronic
987304839 5:16627621-16627643 CTGTAGTGTAGGATTTGAATTGG + Intergenic
991379976 5:66010663-66010685 ATGTAGTGATGAAGTTGAAAGGG + Intronic
993602870 5:89950363-89950385 GTGGAGTGCAGGAGTTGAAATGG + Intergenic
998646389 5:144066809-144066831 TTGTAGTGAGGGAGTGGAATTGG + Intergenic
999211424 5:149892670-149892692 TTGTAGTGATGGAGTTTCACAGG + Intronic
999717101 5:154370156-154370178 TTGAAGTGAAGGTGTTGAACTGG + Intronic
999828587 5:155297894-155297916 GTGTGGCGAAGGAGTTAGACTGG + Intergenic
1002476151 5:179467550-179467572 GTGTTGGGAAGGTGGTGAACTGG - Intergenic
1005726294 6:28652038-28652060 GTGTAGTGAATGAGTTGAGGTGG + Intergenic
1007537316 6:42604631-42604653 GTGTAGAGAATGAATTGTACGGG - Intronic
1008349432 6:50472712-50472734 GTGTAATGGATGTGTTGAACAGG - Intergenic
1009736316 6:67680511-67680533 TTGTAGTTAAGGAGTGGAGCTGG - Intergenic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1010870371 6:81029725-81029747 ATGTAATGAAAGAGTTGAATTGG - Intergenic
1011497438 6:87950418-87950440 GTATAGAGAAGGAGTGCAACAGG - Intergenic
1012682932 6:102205847-102205869 GTGTTGGGAATGAATTGAACAGG - Intergenic
1012979180 6:105811996-105812018 GTGTTGTGCAGGAGATGAACAGG + Intergenic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1016701153 6:147055689-147055711 CTAAAATGAAGGAGTTGAACTGG - Intergenic
1016963937 6:149700526-149700548 TTGTAGTAAAGGATTTGAAAAGG - Intronic
1018649741 6:165983414-165983436 TGGTAGGGAAGGAGGTGAACAGG + Intronic
1020191635 7:6004292-6004314 GTGAAGTGAAGCAGTTGGAGTGG + Intronic
1022289882 7:28990676-28990698 GTGTGATGGTGGAGTTGAACAGG + Intergenic
1027053154 7:75032230-75032252 GTGGGGGGAAGGAGTTGGACGGG + Intronic
1028456401 7:91042452-91042474 GTCTAGTGATGCAGATGAACAGG - Intronic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1029198000 7:98819860-98819882 GTGAAGTCAAGGAGTCGGACAGG + Intergenic
1029906767 7:104100645-104100667 CTCTAGTGAAGGAGATGACCAGG - Intergenic
1029931390 7:104374890-104374912 GTTTAGTGAAGTAGTAGAATTGG + Intronic
1032811672 7:135425826-135425848 GTGTAGTGAAGGAATTGTAATGG - Intronic
1032837311 7:135686176-135686198 GTGTTTTTAAGGAGATGAACAGG + Intronic
1039428714 8:37508169-37508191 GTGAGTTGAATGAGTTGAACTGG - Intergenic
1041956604 8:63562948-63562970 GTGTAGGGAAGTGGGTGAACAGG - Intergenic
1042454822 8:68988935-68988957 GTGTAGAGAAGGAATTGGAATGG + Intergenic
1044710956 8:95057370-95057392 ATTTTGTGAAGAAGTTGAACAGG - Intronic
1045663097 8:104458330-104458352 GTGGAGTGAATGAGTTGAGAGGG - Intronic
1048171546 8:132111420-132111442 GTGTATTGAAGGAGTAGAACAGG + Intergenic
1050916916 9:11147950-11147972 GTATCTTGAAGGTGTTGAACCGG + Intergenic
1055030127 9:71765827-71765849 GTAAAGAGAAGGAGTTGAAGTGG - Intronic
1058068563 9:100577277-100577299 GTGTATTAAAGTAGTTTAACTGG - Exonic
1058099973 9:100908078-100908100 GGGAAGTGCAGGAGTGGAACAGG - Intergenic
1060829109 9:126702734-126702756 GTGTAGAGGAGGACATGAACCGG - Intergenic
1060928775 9:127474723-127474745 GTCTAGTGAAGGAGTCAGACAGG + Intronic
1186575045 X:10756527-10756549 GTGAAGTGAGGGAGTTGGACTGG - Intronic
1189840883 X:45076175-45076197 GTATAGTCAAGGAGTTGCATAGG + Intronic
1191958064 X:66667775-66667797 GTGTAGTGAATGAATTGTAAGGG + Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1192536553 X:71933417-71933439 GTGAGGAGAAGGAATTGAACAGG + Intergenic
1199133375 X:144221326-144221348 CTGTAGGGAAAGAGTTGTACTGG + Intergenic
1201621944 Y:15968943-15968965 GTGTTGGGAAAGAGCTGAACAGG + Intergenic