ID: 1192130379

View in Genome Browser
Species Human (GRCh38)
Location X:68544060-68544082
Sequence TTGGCCTCTCACAGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192130379_1192130388 29 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130388 X:68544112-68544134 TAGAAGTAGGGGAAGACAAAAGG No data
1192130379_1192130386 17 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130386 X:68544100-68544122 CCAGGCAGCAGTTAGAAGTAGGG No data
1192130379_1192130389 30 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130389 X:68544113-68544135 AGAAGTAGGGGAAGACAAAAGGG No data
1192130379_1192130381 -1 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130381 X:68544082-68544104 ATTCATTATACCTACCTGCCAGG No data
1192130379_1192130384 16 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130384 X:68544099-68544121 GCCAGGCAGCAGTTAGAAGTAGG No data
1192130379_1192130387 18 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130387 X:68544101-68544123 CAGGCAGCAGTTAGAAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192130379 Original CRISPR TTGGCCTCTCACAGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr