ID: 1192130384

View in Genome Browser
Species Human (GRCh38)
Location X:68544099-68544121
Sequence GCCAGGCAGCAGTTAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192130377_1192130384 29 Left 1192130377 X:68544047-68544069 CCTTTCTGATGGTCCAAGATGGC No data
Right 1192130384 X:68544099-68544121 GCCAGGCAGCAGTTAGAAGTAGG No data
1192130380_1192130384 -3 Left 1192130380 X:68544079-68544101 CCAATTCATTATACCTACCTGCC No data
Right 1192130384 X:68544099-68544121 GCCAGGCAGCAGTTAGAAGTAGG No data
1192130379_1192130384 16 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130384 X:68544099-68544121 GCCAGGCAGCAGTTAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192130384 Original CRISPR GCCAGGCAGCAGTTAGAAGT AGG Intergenic
No off target data available for this crispr