ID: 1192130386

View in Genome Browser
Species Human (GRCh38)
Location X:68544100-68544122
Sequence CCAGGCAGCAGTTAGAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192130377_1192130386 30 Left 1192130377 X:68544047-68544069 CCTTTCTGATGGTCCAAGATGGC No data
Right 1192130386 X:68544100-68544122 CCAGGCAGCAGTTAGAAGTAGGG No data
1192130380_1192130386 -2 Left 1192130380 X:68544079-68544101 CCAATTCATTATACCTACCTGCC No data
Right 1192130386 X:68544100-68544122 CCAGGCAGCAGTTAGAAGTAGGG No data
1192130379_1192130386 17 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130386 X:68544100-68544122 CCAGGCAGCAGTTAGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192130386 Original CRISPR CCAGGCAGCAGTTAGAAGTA GGG Intergenic
No off target data available for this crispr