ID: 1192130388

View in Genome Browser
Species Human (GRCh38)
Location X:68544112-68544134
Sequence TAGAAGTAGGGGAAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192130383_1192130388 -7 Left 1192130383 X:68544096-68544118 CCTGCCAGGCAGCAGTTAGAAGT No data
Right 1192130388 X:68544112-68544134 TAGAAGTAGGGGAAGACAAAAGG No data
1192130380_1192130388 10 Left 1192130380 X:68544079-68544101 CCAATTCATTATACCTACCTGCC No data
Right 1192130388 X:68544112-68544134 TAGAAGTAGGGGAAGACAAAAGG No data
1192130379_1192130388 29 Left 1192130379 X:68544060-68544082 CCAAGATGGCTGTGAGAGGCCAA No data
Right 1192130388 X:68544112-68544134 TAGAAGTAGGGGAAGACAAAAGG No data
1192130382_1192130388 -3 Left 1192130382 X:68544092-68544114 CCTACCTGCCAGGCAGCAGTTAG No data
Right 1192130388 X:68544112-68544134 TAGAAGTAGGGGAAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192130388 Original CRISPR TAGAAGTAGGGGAAGACAAA AGG Intergenic
No off target data available for this crispr