ID: 1192131112

View in Genome Browser
Species Human (GRCh38)
Location X:68551530-68551552
Sequence GAATGTCCTCAACCGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192131110_1192131112 -9 Left 1192131110 X:68551516-68551538 CCAACAAATGGAAGGAATGTCCT No data
Right 1192131112 X:68551530-68551552 GAATGTCCTCAACCGATAAAGGG No data
1192131108_1192131112 -2 Left 1192131108 X:68551509-68551531 CCTTCACCCAACAAATGGAAGGA No data
Right 1192131112 X:68551530-68551552 GAATGTCCTCAACCGATAAAGGG No data
1192131109_1192131112 -8 Left 1192131109 X:68551515-68551537 CCCAACAAATGGAAGGAATGTCC No data
Right 1192131112 X:68551530-68551552 GAATGTCCTCAACCGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192131112 Original CRISPR GAATGTCCTCAACCGATAAA GGG Intergenic
No off target data available for this crispr