ID: 1192139185

View in Genome Browser
Species Human (GRCh38)
Location X:68633017-68633039
Sequence CTGAGCAAGCCCTTCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192139185_1192139189 28 Left 1192139185 X:68633017-68633039 CCTTTCCAGAAGGGCTTGCTCAG No data
Right 1192139189 X:68633068-68633090 GTGTGCTCCTTCAAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192139185 Original CRISPR CTGAGCAAGCCCTTCTGGAA AGG (reversed) Intergenic
No off target data available for this crispr