ID: 1192140844

View in Genome Browser
Species Human (GRCh38)
Location X:68646471-68646493
Sequence CCAGGTCCTGGGACCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140844_1192140851 -1 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140851 X:68646493-68646515 GCTGTTTGCCTGACTAGCTTGGG No data
1192140844_1192140853 19 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140853 X:68646513-68646535 GGGTCTCTGAAACAGAAGTGAGG No data
1192140844_1192140850 -2 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140850 X:68646492-68646514 GGCTGTTTGCCTGACTAGCTTGG No data
1192140844_1192140855 25 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG No data
1192140844_1192140854 24 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140844 Original CRISPR CCAGGTCCTGGGACCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr