ID: 1192140847

View in Genome Browser
Species Human (GRCh38)
Location X:68646482-68646504
Sequence CAGGCAAACAGCCAGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140847_1192140853 8 Left 1192140847 X:68646482-68646504 CCCAGGACCTGGCTGTTTGCCTG No data
Right 1192140853 X:68646513-68646535 GGGTCTCTGAAACAGAAGTGAGG No data
1192140847_1192140854 13 Left 1192140847 X:68646482-68646504 CCCAGGACCTGGCTGTTTGCCTG No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140847_1192140855 14 Left 1192140847 X:68646482-68646504 CCCAGGACCTGGCTGTTTGCCTG No data
Right 1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140847 Original CRISPR CAGGCAAACAGCCAGGTCCT GGG (reversed) Intergenic
No off target data available for this crispr