ID: 1192140852

View in Genome Browser
Species Human (GRCh38)
Location X:68646501-68646523
Sequence TTCAGAGACCCAAGCTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140852_1192140858 13 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140858 X:68646537-68646559 CAGGGAGAGTTAGTTATTCTGGG No data
1192140852_1192140854 -6 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140852_1192140855 -5 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG No data
1192140852_1192140857 12 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140857 X:68646536-68646558 CCAGGGAGAGTTAGTTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140852 Original CRISPR TTCAGAGACCCAAGCTAGTC AGG (reversed) Intergenic
No off target data available for this crispr