ID: 1192140854

View in Genome Browser
Species Human (GRCh38)
Location X:68646518-68646540
Sequence TCTGAAACAGAAGTGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140848_1192140854 12 Left 1192140848 X:68646483-68646505 CCAGGACCTGGCTGTTTGCCTGA No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140846_1192140854 20 Left 1192140846 X:68646475-68646497 CCAGGGTCCCAGGACCTGGCTGT No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140849_1192140854 6 Left 1192140849 X:68646489-68646511 CCTGGCTGTTTGCCTGACTAGCT No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140847_1192140854 13 Left 1192140847 X:68646482-68646504 CCCAGGACCTGGCTGTTTGCCTG No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140852_1192140854 -6 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data
1192140844_1192140854 24 Left 1192140844 X:68646471-68646493 CCTTCCAGGGTCCCAGGACCTGG No data
Right 1192140854 X:68646518-68646540 TCTGAAACAGAAGTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140854 Original CRISPR TCTGAAACAGAAGTGAGGCC AGG Intergenic
No off target data available for this crispr