ID: 1192140857

View in Genome Browser
Species Human (GRCh38)
Location X:68646536-68646558
Sequence CCAGGGAGAGTTAGTTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140849_1192140857 24 Left 1192140849 X:68646489-68646511 CCTGGCTGTTTGCCTGACTAGCT No data
Right 1192140857 X:68646536-68646558 CCAGGGAGAGTTAGTTATTCTGG No data
1192140848_1192140857 30 Left 1192140848 X:68646483-68646505 CCAGGACCTGGCTGTTTGCCTGA No data
Right 1192140857 X:68646536-68646558 CCAGGGAGAGTTAGTTATTCTGG No data
1192140852_1192140857 12 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140857 X:68646536-68646558 CCAGGGAGAGTTAGTTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140857 Original CRISPR CCAGGGAGAGTTAGTTATTC TGG Intergenic
No off target data available for this crispr