ID: 1192140858

View in Genome Browser
Species Human (GRCh38)
Location X:68646537-68646559
Sequence CAGGGAGAGTTAGTTATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192140852_1192140858 13 Left 1192140852 X:68646501-68646523 CCTGACTAGCTTGGGTCTCTGAA No data
Right 1192140858 X:68646537-68646559 CAGGGAGAGTTAGTTATTCTGGG No data
1192140849_1192140858 25 Left 1192140849 X:68646489-68646511 CCTGGCTGTTTGCCTGACTAGCT No data
Right 1192140858 X:68646537-68646559 CAGGGAGAGTTAGTTATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192140858 Original CRISPR CAGGGAGAGTTAGTTATTCT GGG Intergenic
No off target data available for this crispr