ID: 1192146535

View in Genome Browser
Species Human (GRCh38)
Location X:68686486-68686508
Sequence GCCACGGACGTGGACTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192146525_1192146535 17 Left 1192146525 X:68686446-68686468 CCCAGGCGCGGGGCTGGGGTCCG 0: 1
1: 0
2: 3
3: 25
4: 258
Right 1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1192146526_1192146535 16 Left 1192146526 X:68686447-68686469 CCAGGCGCGGGGCTGGGGTCCGG 0: 1
1: 0
2: 4
3: 60
4: 565
Right 1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1192146529_1192146535 -3 Left 1192146529 X:68686466-68686488 CCGGCGTTGCGGTTCCCGAAGCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192146535 Original CRISPR GCCACGGACGTGGACTCCGT GGG Intronic
900427257 1:2586431-2586453 GCCGCCGACTTGGACCCCGTCGG - Intergenic
901451042 1:9337318-9337340 GCCAAGGACGGGGGCTCAGTGGG + Intronic
902286750 1:15412093-15412115 GCCAAGGACGTGGGCGCCCTGGG - Intronic
912226520 1:107740356-107740378 GCTACTGGCCTGGACTCCGTGGG + Intronic
922228442 1:223665642-223665664 GCCATGGCCGTGGGCTCTGTAGG + Exonic
1066995193 10:42556448-42556470 GCCCCGGACCTGGAATCCCTGGG - Intergenic
1079769057 11:24435481-24435503 GCCACTGAAGTGGTCTCCCTTGG - Intergenic
1090063077 11:123480410-123480432 GCCACTGACATGGACTGGGTGGG - Intergenic
1121436657 14:93925114-93925136 ACCAGGCCCGTGGACTCCGTGGG - Exonic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1152105349 17:78325475-78325497 GTCAGGGACGGGGACTCCGATGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1167483173 19:49745493-49745515 GCCACGGGCATGGTCTCAGTGGG - Intronic
935590742 2:104843975-104843997 GGCACTGATGGGGACTCCGTCGG + Intergenic
937421059 2:121755717-121755739 GCCAAGGAAGTGGACGCCGCAGG - Exonic
948784705 2:240346306-240346328 GCCAAGGGCCTGGACTCCGAGGG - Intergenic
1175269701 20:57725256-57725278 GCCAGGGGTGTGGACTCAGTGGG - Intergenic
1184831976 22:46994532-46994554 GCCAGGGACGTGGCCTCTCTTGG + Intronic
1185145870 22:49136393-49136415 GACATGGACGTGGACTTCCTGGG + Intergenic
1185249819 22:49795264-49795286 GCCACAGACCTGGAGGCCGTGGG - Intronic
950170769 3:10837804-10837826 GCCCCTGCCGTGGACTCTGTCGG + Intronic
968984281 4:3866745-3866767 ACCACGGACGTGGACACAGGAGG + Intergenic
976390003 4:84497666-84497688 GCCGCGGCCGTGGCCGCCGTGGG - Exonic
1012069775 6:94599469-94599491 GACACGCACGTGGAATACGTAGG + Intergenic
1018840300 6:167511645-167511667 GCCAAGGACGGGGATTCCCTAGG - Intergenic
1019597977 7:1867171-1867193 GCCACAGACATGGGCACCGTAGG + Intronic
1036673211 8:10806834-10806856 GCCATGGACGTGGGCTCTGGTGG - Intronic
1044834870 8:96286098-96286120 GCCACGGACGTGCTCTCCTCTGG + Intronic
1047495488 8:125405757-125405779 GCCAGGGAAATGGACTCCCTGGG + Intergenic
1062513853 9:136922459-136922481 GCCACGGAGGTGGTCTTCTTGGG + Intronic
1186512709 X:10142426-10142448 CCCACGCTCGTTGACTCCGTGGG + Exonic
1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG + Intronic