ID: 1192146713

View in Genome Browser
Species Human (GRCh38)
Location X:68687550-68687572
Sequence TCAATTCCATGTTAAATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192146713_1192146715 2 Left 1192146713 X:68687550-68687572 CCATAGATTTAACATGGAATTGA 0: 1
1: 0
2: 1
3: 16
4: 206
Right 1192146715 X:68687575-68687597 ACGCTGAAACACAGGATCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1192146713_1192146714 -6 Left 1192146713 X:68687550-68687572 CCATAGATTTAACATGGAATTGA 0: 1
1: 0
2: 1
3: 16
4: 206
Right 1192146714 X:68687567-68687589 AATTGAACACGCTGAAACACAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192146713 Original CRISPR TCAATTCCATGTTAAATCTA TGG (reversed) Intronic
906837708 1:49101761-49101783 TCTGTTCCATTTTCAATCTAGGG + Intronic
906858655 1:49334909-49334931 TCAATTCCAGTTTGAAGCTAGGG + Intronic
906863167 1:49384188-49384210 TTAATTCCATATTAGATATATGG - Intronic
906959200 1:50405461-50405483 TCCATTCAATGTTGTATCTATGG + Intergenic
907699239 1:56766988-56767010 TCTATTCCATGTTATATTTATGG + Intronic
908754632 1:67457817-67457839 TCAACCCCATGTTAACTATAGGG - Intergenic
911433804 1:97829078-97829100 TAAATTCCATAAGAAATCTAGGG - Intronic
911705638 1:101009212-101009234 TCAATTCTATGATTAATCTATGG + Intronic
911777086 1:101828264-101828286 TCATTTCCATTTTAAAGATAAGG - Intronic
917010122 1:170461776-170461798 TCAATACCCTGTTAAGTCCAGGG + Intergenic
917952389 1:180053076-180053098 TCTTTTCCATGTTAAATCTGCGG - Exonic
919203506 1:194390499-194390521 TCAATTCCATTTTAAGTGTGCGG - Intergenic
921504254 1:215947499-215947521 TCATTTTCATTTTAAATCAATGG + Intronic
921532498 1:216301944-216301966 GCAATTCCATGGTAATTCAAAGG + Intronic
923990589 1:239432774-239432796 TCAAATCCATTTTCTATCTAAGG + Intronic
924298004 1:242608206-242608228 TCAACTCCATGATAATTTTATGG + Intergenic
924739416 1:246786082-246786104 TCAATTCCATGTTAAGTCCCTGG + Intergenic
1064296821 10:14086293-14086315 TTAATTACATGTTCAGTCTACGG - Intronic
1064579752 10:16782238-16782260 TCTATTCAATGTTAAACCAAAGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064636644 10:17375201-17375223 TCCATTCTACTTTAAATCTATGG - Intronic
1067528597 10:47053741-47053763 ACGATTCCATATTAAATGTAGGG + Intergenic
1067787789 10:49263343-49263365 TCAATTCCAAGTGAAATCCCAGG + Intergenic
1067899510 10:50224414-50224436 TTAATACAATGTTAAATATATGG + Intronic
1068219117 10:54020974-54020996 TCAAATCCTAGTTAAATCAAAGG - Intronic
1068816533 10:61321519-61321541 TCAGTTCCATGTGAATTCTGTGG - Intergenic
1071231571 10:83593842-83593864 TGATTTCCTTGTTAAATTTATGG + Intergenic
1071820935 10:89280108-89280130 TCAATTCAATGATAAATCTTGGG - Intronic
1073956343 10:108875721-108875743 TGATTTCCATGTTAACTCTTGGG - Intergenic
1075349915 10:121714848-121714870 TCATTAACACGTTAAATCTATGG + Intergenic
1078570502 11:12453672-12453694 TCAAAACCATGTTTAACCTATGG - Intronic
1078878485 11:15423306-15423328 TCAATTCCATCCAAACTCTATGG + Intergenic
1079854799 11:25589132-25589154 AAAATGCCATGTTAAATCAAAGG + Intergenic
1080765390 11:35291733-35291755 TCAATGCCAAGTTAACTCTGGGG + Intronic
1080831170 11:35894578-35894600 TGACTTCCATGTTAAGTCAAGGG - Intergenic
1081743093 11:45454525-45454547 TCAATTCCATTCTAATTCTTAGG + Intergenic
1082890480 11:58133563-58133585 TCAGTTCCATGTTATAGATAAGG - Intronic
1084600425 11:70142310-70142332 TCAACTCCATGTAAAATCTCAGG - Intronic
1085437891 11:76525515-76525537 TCATTTCCATCTTAAGTTTATGG + Intronic
1085907714 11:80784439-80784461 TCAAATCCATTTGAAATCTTGGG - Intergenic
1085928718 11:81055211-81055233 TTATTTCCATTTTAAATGTAAGG - Intergenic
1087515148 11:99150724-99150746 TCAATTCTATTTTAAAGTTAAGG + Intronic
1090138847 11:124231061-124231083 GCATTTCCATGTGAAATTTATGG + Intergenic
1093674291 12:21917539-21917561 TGAATTCCATGATAATTCCAGGG - Intronic
1094821408 12:34228899-34228921 TAAATTCTATGTAAAATCCAAGG + Intergenic
1095093571 12:38130406-38130428 TAAATTCTATGTAAAATCCAGGG - Intergenic
1097141509 12:56906212-56906234 TCAATTACATGTTGAATTAAAGG - Intergenic
1098386955 12:69929814-69929836 TCAATCCCATTTTAAAAATAGGG - Intronic
1098646935 12:72913864-72913886 TCAAATCAATGTTAAATAGAAGG + Intergenic
1099510908 12:83535961-83535983 TCAATACCTTGTTAAAACTATGG + Intergenic
1099590978 12:84589747-84589769 TTAATTCCTTGTCAAATGTATGG - Intergenic
1099731777 12:86513305-86513327 TCAAATTCATGTTAAATATAAGG + Intronic
1104517994 12:129445696-129445718 TCACTTCCATCTTAAAGCTCTGG + Intronic
1107382850 13:39875770-39875792 TCCCTTACATGTTAAATCAAAGG - Intergenic
1108272095 13:48771497-48771519 TCATTTCCATCTTCAATCTTGGG - Intergenic
1108638432 13:52359277-52359299 TCAATCACATTTTAAATATATGG + Intergenic
1110300971 13:73926978-73927000 TCAATTCCATGTTAACACTTTGG - Intronic
1110357228 13:74581010-74581032 TCAGTTCCAGATTTAATCTAAGG + Intergenic
1111229501 13:85325311-85325333 TAAATTCCATATTTAACCTATGG + Intergenic
1111451136 13:88418785-88418807 TTAATTCCATTTAAAATCTAGGG - Intergenic
1111484506 13:88879175-88879197 TTTTTTCCATGTTTAATCTATGG + Intergenic
1114628436 14:24144419-24144441 TCATTTCCATCTTCAATCTTGGG + Exonic
1115037251 14:28873033-28873055 ACATTTCCATGGTAAATATAAGG + Intergenic
1127098576 15:55537961-55537983 TCAAAACCATGCTAAATCCAAGG - Intergenic
1132446432 15:101925050-101925072 TGAATTCCATGAATAATCTATGG - Intergenic
1135157590 16:20066439-20066461 TCAATTCCATCATAAGCCTAGGG - Intronic
1138998527 16:62480403-62480425 TTATTTCCATGTTCAATTTATGG - Intergenic
1139498660 16:67342047-67342069 CAAATTCCTTGATAAATCTAAGG - Exonic
1141453906 16:84125673-84125695 TCTGTTCCATGTAGAATCTAGGG - Intronic
1144058893 17:11563790-11563812 TGAATTCCATGTTTATTATATGG + Exonic
1144281168 17:13728129-13728151 TCACTTGTATGTTGAATCTAAGG - Intergenic
1149075517 17:52593322-52593344 TCAATTGCATTTTTAATCTCTGG + Intergenic
1154121189 18:11653963-11653985 TCATTTCCATTTGTAATCTAGGG + Intergenic
1155523681 18:26695074-26695096 TCATTCCCATGTTAAAGATATGG + Intergenic
1156325504 18:36071323-36071345 TCAATTCCATATGAATTTTAAGG - Intergenic
1156557979 18:38089022-38089044 TTAATCCTATGTTAAATCTATGG + Intergenic
1158969246 18:62651074-62651096 TAAATACCATGTCAAATCCAGGG + Intergenic
1159488063 18:69092587-69092609 ACAATTGCATGTCAAATATACGG + Intergenic
1168027731 19:53655591-53655613 TCATTTCAATGTTTAATTTATGG - Intergenic
926743378 2:16130464-16130486 TCACTTCCTTGTTAATTCTGAGG + Intergenic
927088501 2:19692969-19692991 TCAATTCCAGGATACATGTATGG + Intergenic
927303890 2:21548165-21548187 TCAAATCTATGTTTTATCTAAGG - Intergenic
928666181 2:33552648-33552670 TAAATTCCATTTTAAGTTTAAGG + Intronic
929040289 2:37738028-37738050 TCATTTCCATGTTAGATTTGTGG + Intronic
929213770 2:39388494-39388516 TAGATTCCAAGTTTAATCTAAGG - Intronic
933321251 2:80778188-80778210 TCAATTCCATACTAACTCTGTGG - Intergenic
934582723 2:95458411-95458433 ACAATTCCATGTGAAATTTTAGG + Intergenic
934596727 2:95618303-95618325 ACAATTCCATGTGAAATTTTAGG - Intergenic
934786046 2:97007256-97007278 ACAATTCCATGTAAAATTTTAGG + Intronic
940144468 2:150531830-150531852 TCAATTCTGTGTTAAATGTGTGG + Intronic
940676505 2:156730264-156730286 TTAATTCCTTTTTACATCTAAGG + Intergenic
941620851 2:167777225-167777247 TCATTTTCATATTAAATATATGG - Intergenic
943196013 2:184750897-184750919 TCACTTATATGTAAAATCTAAGG - Intronic
943672011 2:190672910-190672932 TCATTTCCAAGTTAACACTAGGG - Intronic
945439824 2:209865010-209865032 ACAATTCCATGTTAAAAGCACGG + Intronic
946120490 2:217508852-217508874 TCAATTCAATGTGAATTTTAGGG - Intronic
946135176 2:217640192-217640214 TCACTTACATATTATATCTAGGG + Intronic
1170281824 20:14657757-14657779 TCAAATACATGATAATTCTAGGG + Intronic
1170921796 20:20686235-20686257 TCAATTTCATCTTAAAAATAGGG + Intronic
1172542034 20:35726028-35726050 TCAATTCCTTCTAAAAACTAAGG + Intronic
1175423229 20:58849012-58849034 GCAATTCCTATTTAAATCTAAGG + Intronic
1177918231 21:27117481-27117503 TCAATTTCATGTTAAACTTTTGG + Intergenic
1178837698 21:36112398-36112420 TAAGTTACATGATAAATCTATGG - Intergenic
1179199239 21:39200079-39200101 TCATTTCCTTCCTAAATCTAAGG + Intronic
1203292562 22_KI270736v1_random:9570-9592 TCATTTCCATGTTAGATTTGTGG + Intergenic
951485634 3:23206071-23206093 TCCATTCCATGACAAATATATGG - Intronic
953267111 3:41401503-41401525 TCAGTTCCGTGTTGTATCTATGG + Intronic
954294911 3:49668887-49668909 TAAATTCCATGTTATGTATAAGG + Exonic
954570291 3:51635229-51635251 TCAATCCCATGATAAATACAAGG - Intronic
955616358 3:60811661-60811683 TCATTTCCATGTTATATGTGAGG - Intronic
957313036 3:78543781-78543803 TCAATTTCCTGTTAAACATAGGG + Intergenic
957379526 3:79407985-79408007 TCAATTCTATGTTATGTCTATGG + Intronic
958559485 3:95726975-95726997 TATATTCAATGTTATATCTAAGG - Intergenic
958745760 3:98131989-98132011 TCAAATGCATGTTAAATGTATGG - Intergenic
959337637 3:105086368-105086390 TTAATTCTATTTTAAATTTATGG - Intergenic
959792830 3:110385065-110385087 TCTTTTTGATGTTAAATCTAGGG - Intergenic
960626274 3:119685231-119685253 TGAAATCCATGTTAAAGCCAAGG + Intergenic
961027576 3:123572715-123572737 TCAATTTCATTTTTAATCCAAGG + Intronic
962490358 3:135887626-135887648 TCCATTCCATGATATCTCTATGG + Intergenic
962522038 3:136206258-136206280 TCAAATCAATGTTAATTATAAGG + Intergenic
965385789 3:168045029-168045051 TCATTTCTGTGTTAAATCGATGG - Intronic
965516457 3:169626789-169626811 ACAATTCCATGTGAATTTTAAGG + Intronic
965830799 3:172786606-172786628 TCAATTCCATTCGAAATCTAAGG - Intronic
967614139 3:191545177-191545199 TCAAATCCATTTAAAATATAAGG - Intergenic
968395873 4:237515-237537 TCATTTGCATTTTAAATATATGG + Intergenic
968864244 4:3197662-3197684 TTAATTCCATCTTACACCTAAGG + Intronic
970566551 4:17337437-17337459 TGAATCCCTTGGTAAATCTAAGG + Intergenic
971652897 4:29302511-29302533 TCACTTCCATGTACAATCTTTGG - Intergenic
972035868 4:34519805-34519827 TCAATTCAATGCAAAAACTATGG + Intergenic
972052714 4:34759193-34759215 TCAATTGCAAGTTAATTGTAAGG + Intergenic
975299976 4:72778699-72778721 TCAAATCCATTTTTAATTTAAGG - Intergenic
975631326 4:76405705-76405727 TCTATTCCATTTTAAGTCAATGG - Intronic
978135513 4:105253737-105253759 TCAATTTTATGTTAGCTCTATGG + Intronic
978340291 4:107715363-107715385 TCAATTCTCTGTTAAACCTGGGG + Intronic
978640101 4:110860551-110860573 TCATTTCTATTTTTAATCTATGG - Intergenic
978789868 4:112650717-112650739 TTAATTCCATGGTAACTCTTAGG + Intronic
980620083 4:135289745-135289767 TCAATTCCTTGTCAAAGATAAGG - Intergenic
980650409 4:135706694-135706716 TCAAAGCCAGGTTAAGTCTAAGG + Intergenic
982757931 4:159246413-159246435 TCAGTCCCATTTTAAAACTAAGG + Intronic
983180745 4:164645651-164645673 TGAATTGAATGTTAAATATATGG - Intergenic
983967908 4:173836010-173836032 TCATTTCTATGTTAAATCACAGG + Intergenic
987573408 5:19695352-19695374 TCACTGCAGTGTTAAATCTAAGG + Intronic
988895321 5:35666122-35666144 TGAATTCTATATAAAATCTAGGG + Intronic
989038659 5:37203190-37203212 TCAATTCCCTGTTTATTCTCAGG + Intronic
990406327 5:55494598-55494620 TCAAATCCCTGTGAAACCTAGGG - Intronic
994122471 5:96132096-96132118 TCAATCCAATCTTAAATGTATGG + Intergenic
994189858 5:96857560-96857582 TCAATCCCATTTTAAAGATAAGG + Intronic
995215842 5:109593291-109593313 TCACCTCCATATTAAATCTGTGG - Intergenic
996290127 5:121843008-121843030 TCAGTTATATGTGAAATCTAAGG + Intergenic
996671984 5:126128669-126128691 ACAATTTAATCTTAAATCTATGG - Intergenic
997156468 5:131565499-131565521 ACAATTCCATGTAAATTTTAGGG - Intronic
997590723 5:135070559-135070581 TCAAATCTATTCTAAATCTAAGG - Intronic
999592576 5:153164653-153164675 TCAAGTCCATGCTAAATGTCAGG - Intergenic
1001011715 5:168104805-168104827 TCCATTCCATGTTATTTCCATGG - Intronic
1002166331 5:177349729-177349751 TCATTTCCATGAAAAATATAAGG + Intronic
1004790372 6:19019500-19019522 TCAATTCCATGGTCTATCTGAGG - Intergenic
1008812899 6:55526694-55526716 TGAGTTACATGTTAAACCTATGG + Intronic
1010117686 6:72334569-72334591 TCAATACTATGTAAAATCAAAGG + Intronic
1011783036 6:90811928-90811950 TGAATTCCACGTTAGATCAAGGG - Intergenic
1012183620 6:96186722-96186744 TCAATTCCATTTCAGATCTAAGG + Intronic
1014038476 6:116796157-116796179 TCAATCCCATGTTGAATGAAGGG + Intronic
1014584310 6:123180217-123180239 AGAATTCCAAGATAAATCTAAGG + Intergenic
1016854533 6:148653608-148653630 TTATTTCAATGTTAAATTTATGG - Intergenic
1017237755 6:152134782-152134804 TAAACTTCATGTTACATCTATGG - Intronic
1018272064 6:162090834-162090856 CAAATTCCATGGTAAATCTTAGG - Intronic
1018448973 6:163887746-163887768 TCAATGCCCTGTGAATTCTAAGG - Intergenic
1021380827 7:19963929-19963951 ACATTTCCATGTGAAATTTAGGG + Intergenic
1021495701 7:21272106-21272128 TTAATTTCATGTAAAATATAGGG - Intergenic
1024913990 7:54477971-54477993 TCAATTTTTTTTTAAATCTACGG - Intergenic
1026976203 7:74500238-74500260 TCTAATCCATGTTACATCTGGGG - Intronic
1027380786 7:77607267-77607289 TAAATTCCACGTATAATCTATGG - Exonic
1027674103 7:81138007-81138029 ACAATTTCATCTTAAAGCTAGGG + Intergenic
1027912966 7:84276989-84277011 TGAATTCCAAGTCAAATTTATGG + Intronic
1028449026 7:90959293-90959315 TAAAATCTATGTTATATCTATGG + Intronic
1032549921 7:132775397-132775419 TCAATTGCATGTTAAAACTAGGG - Intergenic
1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG + Intergenic
1033324522 7:140366498-140366520 TCAATGCCATGAAAAATCAATGG - Intronic
1034683454 7:152948848-152948870 TCATTTCCAGGTTAAAGGTAAGG + Intergenic
1035067623 7:156119772-156119794 TCCAGTCCATGTGAAATCAAGGG + Intergenic
1037327963 8:17713406-17713428 TCAAGTGCATTTTAAATATAAGG + Intronic
1038072873 8:24036767-24036789 TCACTTACATGTGGAATCTAAGG - Intergenic
1038198430 8:25389365-25389387 CCCATTCCATGTAAAATCTTTGG + Intronic
1040837605 8:51748650-51748672 TCATTTCCTTTTTAATTCTATGG - Intronic
1042718455 8:71801746-71801768 TCATTCCCATTTTAAAACTAAGG - Intergenic
1043695038 8:83207421-83207443 TCAATAACATGGTAACTCTAAGG + Intergenic
1043980680 8:86635329-86635351 TCAATTCCATGATAAGTGTTGGG + Intronic
1044053349 8:87537532-87537554 TATATTCCATGTTAAATGTCTGG - Intronic
1045568693 8:103347749-103347771 TAAAGTCCATTTTAAATCAATGG - Intergenic
1045889057 8:107132595-107132617 TCAATTTCATTTTAAACCAATGG - Intergenic
1046379790 8:113436115-113436137 TCTATGCAATGTTAAATGTAGGG - Intronic
1046538273 8:115544815-115544837 TCAATTACTTGTAAAATCTGAGG - Intronic
1047709124 8:127532800-127532822 ATAATTCTATGTTAAACCTAAGG - Intergenic
1050418359 9:5437547-5437569 TCAACTCTATTTTAAAGCTACGG + Intronic
1050710098 9:8451660-8451682 TCAATTCCACGTGAAACATATGG + Intronic
1050847192 9:10236441-10236463 TCAATTCCATGTTATCCCAAGGG + Intronic
1050969323 9:11848192-11848214 TTAAATCAATTTTAAATCTAGGG - Intergenic
1051495328 9:17716478-17716500 TCAATTCCAGGTCAATTATAAGG + Intronic
1051579475 9:18655214-18655236 TTAATTCCATGTAAAATTCAAGG - Intronic
1052248778 9:26372068-26372090 GTAATTCCATATTAAATATATGG - Intergenic
1052441484 9:28501805-28501827 TCAATTACATTGTAAATCGATGG - Intronic
1053401089 9:37823493-37823515 TCAATACCATGTTATGTCCAGGG + Intronic
1057095028 9:92298590-92298612 TAAATTCCATGTGAAAACTCAGG - Intronic
1060654927 9:125364961-125364983 TCTATTCCATGTTAACACTGTGG + Intronic
1062694947 9:137869160-137869182 TTAAATCTATGTTATATCTATGG - Intronic
1186547587 X:10466791-10466813 TTAATTCCACGTTAAGTTTATGG + Intronic
1191958923 X:66677900-66677922 TGATTTCCATCTTAAATGTATGG + Intergenic
1192146713 X:68687550-68687572 TCAATTCCATGTTAAATCTATGG - Intronic
1192870877 X:75182559-75182581 TTAATTCCTGGTTAAATCTTGGG + Intergenic
1193680015 X:84507074-84507096 TAAATTACATGTTAAAGTTATGG + Intergenic
1194112231 X:89848688-89848710 TCAATTCCATGTTAACCATGTGG + Intergenic
1194156049 X:90390252-90390274 TAAATTCCAAGTTACATCTCAGG - Intergenic
1194672146 X:96746953-96746975 TCAATTCCACTTTAAATGTAAGG + Intronic
1196038106 X:111169369-111169391 TCCATTCAATGTTGTATCTATGG - Intronic
1197574343 X:128191209-128191231 TCAATTCTTCTTTAAATCTACGG + Intergenic
1197898255 X:131340810-131340832 TTAAATCCATGTTAAATAAAAGG + Intronic
1198706735 X:139457270-139457292 TCAAATCCATCTCAAATTTAAGG + Intergenic
1200464885 Y:3503492-3503514 TCAATTCCATGTTAACCATGTGG + Intergenic
1200502399 Y:3967225-3967247 TAAATTCCAAGTTACATCTCAGG - Intergenic
1200850019 Y:7873412-7873434 TCAATTGGATGTTAGATCCAGGG + Intergenic
1200939355 Y:8765993-8766015 TGAATTCCATGTAAATTCAAGGG + Intergenic
1202271159 Y:23075906-23075928 TCAGATCCATCTTAAATCTCAGG + Intergenic
1202294867 Y:23344776-23344798 TCAGATCCATCTTAAATCTCAGG - Intergenic
1202424154 Y:24709650-24709672 TCAGATCCATCTTAAATCTCAGG + Intergenic
1202446635 Y:24960435-24960457 TCAGATCCATCTTAAATCTCAGG - Intergenic