ID: 1192147805

View in Genome Browser
Species Human (GRCh38)
Location X:68693675-68693697
Sequence AGCCAGAAGAGCAGCTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192147805_1192147818 26 Left 1192147805 X:68693675-68693697 CCGCGGCAGCTGCTCTTCTGGCT 0: 1
1: 0
2: 3
3: 27
4: 232
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147805_1192147808 5 Left 1192147805 X:68693675-68693697 CCGCGGCAGCTGCTCTTCTGGCT 0: 1
1: 0
2: 3
3: 27
4: 232
Right 1192147808 X:68693703-68693725 CGTCACCCCTGCCCGACCCCAGG 0: 1
1: 0
2: 3
3: 30
4: 250
1192147805_1192147816 22 Left 1192147805 X:68693675-68693697 CCGCGGCAGCTGCTCTTCTGGCT 0: 1
1: 0
2: 3
3: 27
4: 232
Right 1192147816 X:68693720-68693742 CCCAGGCCCCGCGTGTGTCCCGG 0: 1
1: 0
2: 1
3: 27
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192147805 Original CRISPR AGCCAGAAGAGCAGCTGCCG CGG (reversed) Intronic