ID: 1192147807

View in Genome Browser
Species Human (GRCh38)
Location X:68693702-68693724
Sequence CTGGGGTCGGGCAGGGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1275
Summary {0: 1, 1: 0, 2: 15, 3: 89, 4: 1170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192147807_1192147824 14 Left 1192147807 X:68693702-68693724 CCGTCACCCCTGCCCGACCCCAG 0: 1
1: 0
2: 15
3: 89
4: 1170
Right 1192147824 X:68693739-68693761 CCGGACGGAGCAGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1192147807_1192147818 -1 Left 1192147807 X:68693702-68693724 CCGTCACCCCTGCCCGACCCCAG 0: 1
1: 0
2: 15
3: 89
4: 1170
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147807_1192147816 -5 Left 1192147807 X:68693702-68693724 CCGTCACCCCTGCCCGACCCCAG 0: 1
1: 0
2: 15
3: 89
4: 1170
Right 1192147816 X:68693720-68693742 CCCAGGCCCCGCGTGTGTCCCGG 0: 1
1: 0
2: 1
3: 27
4: 213
1192147807_1192147825 15 Left 1192147807 X:68693702-68693724 CCGTCACCCCTGCCCGACCCCAG 0: 1
1: 0
2: 15
3: 89
4: 1170
Right 1192147825 X:68693740-68693762 CGGACGGAGCAGTCCCTCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192147807 Original CRISPR CTGGGGTCGGGCAGGGGTGA CGG (reversed) Intronic