ID: 1192147810

View in Genome Browser
Species Human (GRCh38)
Location X:68693709-68693731
Sequence GCGGGGCCTGGGGTCGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192147810_1192147824 7 Left 1192147810 X:68693709-68693731 CCCTGCCCGACCCCAGGCCCCGC 0: 1
1: 0
2: 7
3: 98
4: 785
Right 1192147824 X:68693739-68693761 CCGGACGGAGCAGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1192147810_1192147825 8 Left 1192147810 X:68693709-68693731 CCCTGCCCGACCCCAGGCCCCGC 0: 1
1: 0
2: 7
3: 98
4: 785
Right 1192147825 X:68693740-68693762 CGGACGGAGCAGTCCCTCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 75
1192147810_1192147818 -8 Left 1192147810 X:68693709-68693731 CCCTGCCCGACCCCAGGCCCCGC 0: 1
1: 0
2: 7
3: 98
4: 785
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192147810 Original CRISPR GCGGGGCCTGGGGTCGGGCA GGG (reversed) Intronic