ID: 1192147811

View in Genome Browser
Species Human (GRCh38)
Location X:68693710-68693732
Sequence CGCGGGGCCTGGGGTCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 649}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192147811_1192147818 -9 Left 1192147811 X:68693710-68693732 CCTGCCCGACCCCAGGCCCCGCG 0: 1
1: 0
2: 3
3: 79
4: 649
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147811_1192147824 6 Left 1192147811 X:68693710-68693732 CCTGCCCGACCCCAGGCCCCGCG 0: 1
1: 0
2: 3
3: 79
4: 649
Right 1192147824 X:68693739-68693761 CCGGACGGAGCAGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1192147811_1192147825 7 Left 1192147811 X:68693710-68693732 CCTGCCCGACCCCAGGCCCCGCG 0: 1
1: 0
2: 3
3: 79
4: 649
Right 1192147825 X:68693740-68693762 CGGACGGAGCAGTCCCTCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192147811 Original CRISPR CGCGGGGCCTGGGGTCGGGC AGG (reversed) Intronic