ID: 1192147818

View in Genome Browser
Species Human (GRCh38)
Location X:68693724-68693746
Sequence GGCCCCGCGTGTGTCCCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192147807_1192147818 -1 Left 1192147807 X:68693702-68693724 CCGTCACCCCTGCCCGACCCCAG 0: 1
1: 0
2: 15
3: 89
4: 1170
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147809_1192147818 -7 Left 1192147809 X:68693708-68693730 CCCCTGCCCGACCCCAGGCCCCG 0: 1
1: 1
2: 10
3: 105
4: 1106
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147810_1192147818 -8 Left 1192147810 X:68693709-68693731 CCCTGCCCGACCCCAGGCCCCGC 0: 1
1: 0
2: 7
3: 98
4: 785
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147811_1192147818 -9 Left 1192147811 X:68693710-68693732 CCTGCCCGACCCCAGGCCCCGCG 0: 1
1: 0
2: 3
3: 79
4: 649
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83
1192147805_1192147818 26 Left 1192147805 X:68693675-68693697 CCGCGGCAGCTGCTCTTCTGGCT 0: 1
1: 0
2: 3
3: 27
4: 232
Right 1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192147818 Original CRISPR GGCCCCGCGTGTGTCCCGGA CGG Intronic