ID: 1192148808

View in Genome Browser
Species Human (GRCh38)
Location X:68699179-68699201
Sequence GGCCCTTGGCTGCTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192148808_1192148814 26 Left 1192148808 X:68699179-68699201 CCTGTGGGAAGCAGCCAAGGGCC 0: 1
1: 0
2: 4
3: 28
4: 267
Right 1192148814 X:68699228-68699250 CTCTCCCACAACCCCTCTAGAGG 0: 1
1: 0
2: 0
3: 13
4: 210
1192148808_1192148816 30 Left 1192148808 X:68699179-68699201 CCTGTGGGAAGCAGCCAAGGGCC 0: 1
1: 0
2: 4
3: 28
4: 267
Right 1192148816 X:68699232-68699254 CCCACAACCCCTCTAGAGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192148808 Original CRISPR GGCCCTTGGCTGCTTCCCAC AGG (reversed) Intronic
900143373 1:1147572-1147594 GGCCCCAGCCTGCTCCCCACAGG + Intergenic
900205711 1:1431172-1431194 GGCCCCTGGGTTCTTCCCCCGGG + Intergenic
901051820 1:6429153-6429175 GGCCCTGGGCAGCTTTCCCCAGG - Intronic
901965077 1:12859765-12859787 GGCCCTGTCCTGCTTCCCAGAGG + Exonic
902044627 1:13515074-13515096 AGCCCTTGGCTCCATCCCAGGGG - Intergenic
902432723 1:16375986-16376008 GGAACTTGGGAGCTTCCCACAGG - Intronic
902557814 1:17257278-17257300 GGCCCTGGGCAGCCCCCCACAGG - Intronic
903118355 1:21196666-21196688 GGCCATTCGCTGCATCCTACGGG - Intergenic
903266283 1:22159966-22159988 GGCCCTGGTCAGCTTCCCAAAGG - Intergenic
904131998 1:28282055-28282077 GGTCCTTGGCTGCTTCTGCCTGG - Exonic
904604428 1:31691103-31691125 GGGCCGGGGCAGCTTCCCACAGG - Intronic
904801845 1:33098653-33098675 GGCCCTGGGCTGGGTTCCACAGG - Intronic
905203902 1:36331941-36331963 GGCCTTTGGCTGCTTCATAGAGG - Intergenic
907242283 1:53087509-53087531 GGCCCTGGGCTGCTCCCCTTGGG + Exonic
907272526 1:53299221-53299243 GGTCCCTGGCTGCTACCCACAGG + Intronic
907331639 1:53675791-53675813 GGCCCTGGGCTCCTTCCAATTGG + Intronic
911300340 1:96165162-96165184 CACTCTTGGCTGCATCCCACTGG + Intergenic
911524182 1:98964389-98964411 GGCCCGTTGATCCTTCCCACTGG - Intronic
913212090 1:116590245-116590267 AGACCTTGGCTTCTTGCCACTGG - Intronic
919976378 1:202615642-202615664 GGCCCCTGGCTGGCTCCCACAGG + Intronic
920326537 1:205169403-205169425 GGGCCTTGGCTGCATCCACCAGG + Exonic
920799421 1:209173327-209173349 GCGCGTTGGCTTCTTCCCACGGG + Intergenic
922648863 1:227319009-227319031 GCCCCTTACCTGCTCCCCACCGG + Intergenic
922712903 1:227846297-227846319 GGCCCTTGTCTGCTTCAGAGAGG - Exonic
922821868 1:228490239-228490261 AGCCCTTGCCTGCTATCCACAGG + Intronic
923964745 1:239125035-239125057 TGCCCTTGGCTCCTGCCCTCTGG - Intergenic
924615040 1:245605700-245605722 GGCCCCTTGCTGCTTCCCCTGGG - Intronic
1062807008 10:429412-429434 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807018 10:429433-429455 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807028 10:429454-429476 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807038 10:429475-429497 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807048 10:429496-429518 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1063318709 10:5032662-5032684 GGGCCTTAGCTGCCTCCAACGGG - Intronic
1064461039 10:15535152-15535174 GGGCCTTAGCTGCCTCCCCCAGG + Intronic
1068554036 10:58438078-58438100 GGCCCTTGTCTCCTTCCCTAAGG - Intergenic
1069664426 10:70145443-70145465 GGACCCTGGCTGCTTCCCGAGGG + Exonic
1069744399 10:70706046-70706068 GGCTCATGGCAGCTTCCCAGTGG + Intronic
1069868485 10:71518866-71518888 GGTCCTTGGCTTCACCCCACTGG - Intronic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1070605452 10:77895119-77895141 AGCCCCAGGCTGCTTCCCATGGG + Intronic
1070895823 10:79982305-79982327 GGCGCTGGGCTGGTGCCCACTGG - Intronic
1075442912 10:122493888-122493910 CTTCCTTGGTTGCTTCCCACAGG + Intronic
1075633407 10:124014996-124015018 GGCGCTCGGCTGCTTCTCCCGGG + Intronic
1075965213 10:126605359-126605381 GGCCCCTGCCTGCTCCCCACAGG - Intronic
1076139900 10:128070478-128070500 TGCCCTTGGCTGCTTACACCAGG - Intronic
1076412201 10:130260072-130260094 GGCTCTTGGCTGCTTCTCCGGGG + Intergenic
1076518350 10:131062694-131062716 GGACCTTGCATGCTTCACACAGG - Intergenic
1077186301 11:1236854-1236876 GGCTCTGTGCTGCCTCCCACGGG + Intronic
1077315878 11:1919193-1919215 GGCCCTTCGCTGTCTCCCCCGGG - Intergenic
1077483026 11:2825387-2825409 GGCCCCTGGCACCTTCCCACAGG - Intronic
1077549064 11:3191757-3191779 GGCCCTTGGATCCTTGTCACCGG - Intergenic
1077746834 11:4916018-4916040 GGCCCCTGGGTGCATCCCACTGG - Intronic
1079258469 11:18853236-18853258 GGCACTTGGTGGCTGCCCACTGG + Intergenic
1080044396 11:27794032-27794054 TGCCCTTAGCTGTTTGCCACTGG + Intergenic
1080503070 11:32888355-32888377 GGGCCTTAGCTGCCTCCCCCGGG - Intergenic
1082925731 11:58544867-58544889 GGTCCTTGGCATCCTCCCACAGG - Intronic
1083490936 11:63014765-63014787 GGGCCTTGGGTGCTCCCCATGGG - Exonic
1084106861 11:66986078-66986100 GGCCCTTCCCTGCTGCCCATGGG - Intergenic
1084978675 11:72816925-72816947 AGCCCTTGGCTGCTGCCCAGGGG + Intronic
1085417103 11:76326365-76326387 GGCCCACGTCTGCTTCCCTCTGG + Intergenic
1085863151 11:80257779-80257801 GGGCCTTAGCTGCTTCCCCGCGG + Intergenic
1086590331 11:88508476-88508498 TGCCCTTGGCATCTTCCCCCTGG + Exonic
1087356306 11:97098335-97098357 GGTGCTTGGCAGCTACCCACTGG + Intergenic
1087926407 11:103923675-103923697 AGCCTTTTGCTGTTTCCCACAGG + Intronic
1088812500 11:113401006-113401028 GGCTCTTGGCTCCTTACCTCAGG + Intergenic
1091046606 11:132331033-132331055 GCCACTGGGCTGCTTCCCGCAGG - Intronic
1091874951 12:3925920-3925942 GCCCCATGGCTGCCTCCCTCCGG + Intergenic
1092104194 12:5909527-5909549 GGACCTTGTCTGCTGCCAACTGG - Intronic
1093031887 12:14296030-14296052 AGCCCTTGGCAGCCTCCCATAGG - Intergenic
1095512316 12:42965917-42965939 GGCCCTGGACTGCCTACCACAGG - Intergenic
1095867108 12:46983913-46983935 GGCACTTGGTGGCTGCCCACTGG + Intergenic
1096983730 12:55743376-55743398 GGCCCTCGGCCGCCTCCCCCCGG - Exonic
1099218944 12:79889413-79889435 GGCTCTGAGCTGCTCCCCACTGG + Intronic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1104948763 12:132429351-132429373 CGCAGGTGGCTGCTTCCCACAGG - Intergenic
1105215335 13:18280871-18280893 AGACCTTGGCTTCTTGCCACTGG - Intergenic
1105541416 13:21320262-21320284 GGCGCTAGGCTGCCTCCCGCAGG + Intergenic
1109364654 13:61339381-61339403 GGGCCTTAGCTGCCTCCCAGTGG + Intergenic
1109745837 13:66622165-66622187 GGGCCTTGGCTGCCTCCCTGCGG + Intronic
1112223245 13:97513165-97513187 GGCACTTGGTGGCTGCCCACTGG - Intergenic
1112642813 13:101296019-101296041 GGCCCTGCACTGCTTCCCTCTGG + Intronic
1112880669 13:104102883-104102905 GGCCCTTTGCTTATTCCCTCTGG + Intergenic
1113781268 13:112978984-112979006 GCCCCATGGCTGCTTCCGAGGGG - Intronic
1114485399 14:23058674-23058696 AGCCCTTGCCTCTTTCCCACAGG - Exonic
1115753541 14:36513566-36513588 GGCCCCAGGCTACTTCCCACCGG + Exonic
1116394310 14:44429828-44429850 GGTCCTTTGCTGATTCCAACTGG + Intergenic
1116876386 14:50116286-50116308 GGCTCATGGCTGCTACCCTCGGG - Exonic
1122116036 14:99527729-99527751 GGACCCAGGCAGCTTCCCACCGG + Intronic
1122155822 14:99749900-99749922 GCCCCTTGGCTGCTCCCCGATGG + Intronic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1122781469 14:104145632-104145654 GGCCCTTGCCTGGTGCCCTCAGG + Intronic
1123108895 14:105856125-105856147 GGCCGTTGGCTGCCTCGCACAGG - Intergenic
1123932053 15:25176690-25176712 GGCACTTGGCTGATGGCCACTGG - Intergenic
1124110591 15:26781813-26781835 GGGCCTTAGCTGCTTCCCCGTGG - Intronic
1124221538 15:27854054-27854076 TGCCCTCTGCTGCATCCCACTGG + Intronic
1124399934 15:29339172-29339194 GGCCCCTGGCAGCTGCCCAGCGG + Intronic
1124421217 15:29524657-29524679 CGCCCATTGCTGCTTCCGACTGG - Intronic
1124492025 15:30163992-30164014 GGCCCCTGGCTGGCTCCCACAGG + Intergenic
1124655391 15:31503042-31503064 TGCCCTTGGCTGATCCCCGCTGG + Intronic
1124751512 15:32374325-32374347 GGCCCCTGGCTGGCTCCCACAGG - Intergenic
1125575915 15:40755326-40755348 GCCCCTTGTCTGTTTCCCTCAGG + Exonic
1125721081 15:41845473-41845495 GGCCCCTGCCTCCTTCCCAAAGG - Intronic
1126413106 15:48392533-48392555 GGTTCTTGGCTCCTTGCCACTGG - Intergenic
1127626652 15:60786653-60786675 GGCCCTTTGCTCCTTTCCCCTGG - Intronic
1127766045 15:62186706-62186728 GGGCCTTAGCTGCCTCCCCCAGG - Intergenic
1127965379 15:63919048-63919070 GTCCTGTGGCTGCATCCCACAGG + Intronic
1128728630 15:70006092-70006114 CCCTCTTGGCAGCTTCCCACCGG - Intergenic
1129586836 15:76875973-76875995 GGGCCTTTGCTGCCTCCCAGCGG - Intronic
1129970028 15:79769959-79769981 GGCACCTGCCTGCTGCCCACTGG + Intergenic
1130572786 15:85063432-85063454 GGCACTGGGCTGCTACCCAGGGG - Intronic
1130649258 15:85752715-85752737 GGCCCTGGGCTGGTTCCAACAGG - Intergenic
1132836918 16:1958807-1958829 GGCCCCTGGCTGCTATCCAGGGG - Intergenic
1132879239 16:2154252-2154274 GGCCCATGGCTGCCTCCCTAAGG + Intergenic
1132930005 16:2454249-2454271 GGGCTTTGGCTGCTTCCCCAGGG - Intronic
1132955821 16:2592905-2592927 GGCCCTTGCCTGCCTCCCCGTGG + Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1134354421 16:13467704-13467726 GCCCCTTGGCTCCATCCAACAGG - Intergenic
1135995282 16:27243435-27243457 GGCCATTGGCTGCAGCCCATTGG - Intronic
1136497971 16:30655362-30655384 GGCTCTTGGCTCCTTCCCTTTGG - Exonic
1137444860 16:48525554-48525576 GTCCCTTGGCACCCTCCCACAGG + Intergenic
1138712714 16:58987039-58987061 GGCCCATGGCTGGCTCACACAGG - Intergenic
1140035599 16:71369097-71369119 GGCCCTGGGCTGCTTTCTTCAGG - Intronic
1141974632 16:87507391-87507413 AGACCTCGGCTGCTTTCCACAGG + Intergenic
1142266054 16:89064392-89064414 GGCCCCAGACTGCTGCCCACCGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143708635 17:8718222-8718244 GGGCCTTAGCTGCCTCCCAGCGG - Intergenic
1144063392 17:11602930-11602952 TGACCTTGGCTCCTTCCCATTGG + Intronic
1144667698 17:17112950-17112972 AGCCCTGGGCTGTTTCCCAGCGG + Intronic
1144761839 17:17711459-17711481 GGCCCTTGGCTGCCTCTGAAAGG - Intronic
1145932719 17:28697598-28697620 GGCCTTTACCTTCTTCCCACAGG + Exonic
1146398364 17:32486307-32486329 GCTCCCTGGCTGCTTTCCACAGG + Intergenic
1146930521 17:36774272-36774294 GCCCCATGCCTGCTTCCCAGAGG + Intergenic
1148774827 17:50089421-50089443 GGCCCTGGGGATCTTCCCACAGG + Exonic
1149572771 17:57685410-57685432 GGCCCTTAGCTGCTTCCTCAAGG + Intergenic
1150663020 17:67102045-67102067 GGCCCTTGGCTGCTTGGCTAAGG - Intronic
1152354250 17:79799009-79799031 GGCCGTCGGCGGCCTCCCACGGG - Intronic
1152683727 17:81683592-81683614 GGTCCTTGACCGCTTCGCACAGG - Exonic
1153956492 18:10100954-10100976 GGCCCTAGCCTGGTACCCACAGG - Intergenic
1154057223 18:11023790-11023812 GGGCCTTAGCTGCCTCCCAGCGG - Intronic
1155910150 18:31497511-31497533 GGCCCTTCACTGCTTCCAACAGG - Intergenic
1158627711 18:59085981-59086003 GGACTTTGGCATCTTCCCACTGG - Intergenic
1159365768 18:67464268-67464290 GGCACTTGGTGGCTTCCCACTGG - Intergenic
1159698484 18:71591974-71591996 GGGCCTTGGTTGCATCTCACTGG + Intergenic
1159723207 18:71919452-71919474 GGCAATTGGCGGCTGCCCACTGG + Intergenic
1160333690 18:78018172-78018194 GGCCCCTGGCTCCTGCCCACTGG + Intergenic
1160953741 19:1679991-1680013 GGCCCTTGGCAGCTGCCCCGGGG - Intergenic
1161171782 19:2815748-2815770 GGCCCCTTGCTGCTCCCCAGTGG + Exonic
1162544739 19:11321931-11321953 GGCCTCGGGCTGCCTCCCACTGG - Intronic
1163034239 19:14562286-14562308 GGCCCAGGGCTGCTTCCCGTGGG + Intronic
1163234325 19:16022263-16022285 TCCCCTTGGCTCCTTCCCAGAGG + Intergenic
1164605913 19:29598055-29598077 TGCCCCTGGCTTCTTCCCATCGG - Intergenic
1164766989 19:30779877-30779899 GGAAGTTGGGTGCTTCCCACTGG + Intergenic
1166225414 19:41392102-41392124 AGGCCTTGCCTTCTTCCCACTGG - Intronic
1166830580 19:45637205-45637227 GGTCCTTGTCTGCTTCTCTCTGG - Intronic
1168136848 19:54357497-54357519 GGGACTTGGATTCTTCCCACAGG - Intronic
925350101 2:3195091-3195113 GGTCCTTGGCTGCTCCTCGCAGG + Intronic
926163583 2:10504607-10504629 GGCCCATGCCTGGGTCCCACCGG - Intergenic
927577218 2:24209668-24209690 CTTCCTTTGCTGCTTCCCACGGG - Intronic
930648175 2:53934672-53934694 AACACTTGACTGCTTCCCACTGG + Exonic
931889011 2:66648942-66648964 TGTCCTAGGATGCTTCCCACTGG - Intergenic
932557976 2:72842427-72842449 GGCCCTGGGCACCTTCCCCCTGG + Intergenic
933217441 2:79646308-79646330 AACCCTTGGCTGCTTCACAGAGG + Intronic
934298990 2:91765866-91765888 AGACCTTGGCTTCTTGCCACTGG + Intergenic
937711832 2:124987553-124987575 GGGCCTTAGCTGCTTTCCCCCGG - Intergenic
938344015 2:130554087-130554109 GCCACTTGGCTGCTTCCCACAGG + Intergenic
938345818 2:130566635-130566657 GCCACTTGGCTGCTTCCCACAGG - Intergenic
938421939 2:131153326-131153348 GGCCCCTTCCTGCCTCCCACTGG - Intronic
943091752 2:183383931-183383953 AGCCCATGGCTGCTTCTCATAGG - Intergenic
943222860 2:185132829-185132851 GGGCCTCAGCTGCCTCCCACGGG + Intergenic
946023225 2:216656190-216656212 ATCCCTTGGCTGCGTCCCAGAGG - Intronic
946419359 2:219556339-219556361 GGCCCCTTGCTCCATCCCACTGG + Intronic
946487768 2:220117370-220117392 GGCCCTTGGCTTCCTCCTGCGGG + Intergenic
948409301 2:237746928-237746950 TGCCCCTGACTGCATCCCACTGG + Intronic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
948743601 2:240067778-240067800 GGCTCTTGGCTGCATCACACTGG - Intergenic
1168753153 20:297838-297860 GGACCTCGGCGACTTCCCACCGG + Exonic
1169541048 20:6600100-6600122 GGCCCTGGGATGCCTCACACTGG + Intergenic
1170556745 20:17520863-17520885 GGCCTCTTGCTGCTTTCCACAGG + Intronic
1170877183 20:20261463-20261485 GGCCTTTGGCAGATACCCACTGG - Intronic
1172652354 20:36512843-36512865 GGCTCATGGCTGCAGCCCACTGG - Intronic
1173539828 20:43842962-43842984 TGCCCTTGTCTGCTTTCCAAGGG - Intergenic
1174053617 20:47784189-47784211 GTCCCCTGCCTGTTTCCCACCGG - Intronic
1174067469 20:47875626-47875648 CAGCCTGGGCTGCTTCCCACTGG - Intergenic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1175679624 20:60976558-60976580 GGATCTAAGCTGCTTCCCACTGG - Intergenic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1178263827 21:31124349-31124371 TGCCCTTGCCTCCTTCCCAGTGG - Intronic
1178692104 21:34758866-34758888 GGCACTTGGATGCTGCCTACAGG - Intergenic
1179609728 21:42542353-42542375 GTCCCGGGCCTGCTTCCCACAGG + Intronic
1179803851 21:43825103-43825125 GGCCCTTGGCTTCCTGCCCCAGG - Intergenic
1180159245 21:45991789-45991811 GGCCCTTGGCTGGGCCTCACAGG + Intronic
1181280016 22:21713029-21713051 GGTCCTTGTCTGCCTCCCTCAGG - Intronic
1181315347 22:21967533-21967555 GGCCCTTGGATGCCTCCCGCTGG - Intronic
1181953326 22:26570587-26570609 CGCCCCTGGATGCTCCCCACAGG + Intronic
1182273189 22:29168747-29168769 GGCCCTGGGCAGCAGCCCACAGG + Intergenic
1182310021 22:29397864-29397886 GGGCCTTGGCTAGTTCCCAGGGG + Intronic
1184691611 22:46119806-46119828 GGCACTTGCCTGCTGCCCCCTGG - Intergenic
1185186641 22:49404867-49404889 TGGCCTTGGCTGGTTCTCACAGG + Intergenic
1185335499 22:50269407-50269429 GCCGCTTAGCTGCTGCCCACTGG - Intronic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950493447 3:13319864-13319886 GGCCCTTGGCTGCCAGCCGCGGG + Exonic
950968184 3:17161082-17161104 GGCCCCAGTCTGCTCCCCACTGG - Exonic
953574971 3:44105788-44105810 GGCCCTTGGGCTCTGCCCACAGG - Intergenic
953911024 3:46893108-46893130 GGGCCCTGGCTGCCACCCACCGG - Intronic
954415814 3:50392773-50392795 AGCCCTTGCCTGGGTCCCACAGG + Intronic
954624019 3:52012644-52012666 GGCACTTAGCTCCTCCCCACCGG + Intergenic
957885513 3:86282438-86282460 GGGCCTTTGCTGCCTCCCAGTGG + Intergenic
961356358 3:126342347-126342369 GGCCTGAGGCAGCTTCCCACAGG + Intergenic
962355843 3:134693796-134693818 GTCCTTTGGCTGCTCTCCACAGG + Intronic
964004268 3:151810335-151810357 GGCCTTTGGCTGCTTCGTAGAGG - Intergenic
965079965 3:164022377-164022399 GGCCTTTGGCTGCTTCATAGAGG + Intergenic
966725413 3:183103889-183103911 GGGCCTTGGCTGCCTCCCCGCGG - Intronic
966861142 3:184231310-184231332 GGGCCTTGGCTGCTAGGCACAGG - Intronic
966947359 3:184786349-184786371 AGCCCTCGGCTCCATCCCACAGG - Intergenic
967682190 3:192377221-192377243 GGCCCCTGCCTGCCTCACACGGG + Intronic
969575354 4:8033364-8033386 GGCCCGTGGCAGCCTCCCAGAGG - Intronic
977206539 4:94170061-94170083 GGCCCTTAGCTGCCTCCCCATGG + Intergenic
977633040 4:99264035-99264057 GGCCCTTCTCTGCTTCCCTTGGG + Intergenic
980629943 4:135418112-135418134 AGCCTTTGGCTACTTCCCATGGG - Intergenic
984985948 4:185329625-185329647 GGCCCTTTGCTGATTCCAACTGG - Intronic
985645013 5:1080689-1080711 GGCCCTTGGTTGTTCCCCAGGGG - Intronic
986719219 5:10548448-10548470 GGCCCCTGGCTTCTTTCCAGTGG - Intergenic
989613425 5:43316727-43316749 GGCCCTTGGGGGCGACCCACAGG + Intergenic
992595256 5:78340289-78340311 GGACCATGGCTGCTTACCACAGG + Intergenic
994331301 5:98509493-98509515 AGCCATTCTCTGCTTCCCACAGG - Intergenic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
997932793 5:138086032-138086054 GGACCTTTGCTGCTTCTGACTGG - Intronic
998449836 5:142225750-142225772 GGTCCAGGGCTGATTCCCACAGG + Intergenic
999367628 5:151033440-151033462 GGCTCTGGGCTGCTACCCAGGGG - Intronic
1000060489 5:157651538-157651560 GGCCCTCGGCTACTTCCGAGGGG - Exonic
1000833884 5:166132918-166132940 GGCCTTTGGCTGCTTCATAGAGG + Intergenic
1000904826 5:166952548-166952570 CGCCCTTGGCTTCTACCCACTGG + Intergenic
1001257287 5:170193537-170193559 GGCCCTTGGCTGCATCAGGCTGG + Intergenic
1002355841 5:178627855-178627877 GGCCCTTGAGTGTTCCCCACAGG - Intronic
1002446790 5:179294998-179295020 GGAACTTGGCGGGTTCCCACTGG + Intronic
1003897006 6:10617203-10617225 GGGCCTTAGCTGCCTCCCAGCGG - Intronic
1004022305 6:11786915-11786937 GGCCTTTGGCTGCTTCACAGAGG - Intronic
1004619977 6:17323624-17323646 GGCCTTTGGCTGCTTCGTAGAGG + Intergenic
1005848525 6:29801326-29801348 GGCCCTGGGCTTCTACCCTCTGG + Intergenic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006798618 6:36745759-36745781 GATCCCTGGCTGCTTCCCTCAGG + Intronic
1007267708 6:40609850-40609872 GGCTCTTGGTGCCTTCCCACTGG + Intergenic
1016104711 6:140148264-140148286 GGGCCTTAGCTGCCTCCCCCGGG - Intergenic
1016858900 6:148698186-148698208 GGGCCTTAGCTGCCTCCCAAGGG - Intergenic
1017397742 6:154022411-154022433 GGGCCTGGCCTGCTCCCCACAGG + Intronic
1018808316 6:167278313-167278335 GGCCTTTGGCTGCTTCTCTGTGG - Intronic
1019407007 7:889188-889210 GGGCCCTGGCTGCCTCCCACTGG + Intronic
1020097314 7:5376348-5376370 GGCCCCCGGCTGCTCCCCAGGGG + Intronic
1021789798 7:24193405-24193427 GGCACAAGGCTGCTTCCTACTGG + Intergenic
1022727076 7:32991255-32991277 AGCCTTCGGCTGCTTCCCAGAGG - Intronic
1023089536 7:36604726-36604748 AGCCCTGGACTGCTTCCCTCTGG + Intronic
1024143441 7:46485400-46485422 TGCCCTGGGCTGTGTCCCACTGG + Intergenic
1024659148 7:51476455-51476477 GGCCCTGGGATGGCTCCCACAGG + Intergenic
1025046504 7:55696375-55696397 AGCCTTCGGCTGCTTCCCAGAGG + Intergenic
1025198162 7:56947567-56947589 GGCCCTGGGCTGCCTTCCCCGGG - Intergenic
1025673787 7:63629369-63629391 GGCCCTGGGCTGCCTTCCCCGGG + Intergenic
1026560700 7:71445755-71445777 GGACCTTCTTTGCTTCCCACAGG + Intronic
1027132034 7:75598023-75598045 GGCTCTTGTCTTCTTCCCCCTGG + Intronic
1027202263 7:76071717-76071739 GGCCCGTGGAGGCTGCCCACAGG + Intergenic
1027202567 7:76072896-76072918 GGCCCGTGGAGGCTGCCCACAGG + Intergenic
1029797755 7:102912891-102912913 GGCTCTTGGCTTCCTTCCACTGG - Intronic
1031409224 7:121421947-121421969 GGCCCTTAGCTGCCTCCCCATGG + Intergenic
1032077565 7:128843298-128843320 GGCCCTGGGCTGAATCGCACAGG + Exonic
1032709310 7:134448371-134448393 GGCCCTGGTGAGCTTCCCACAGG - Exonic
1035178691 7:157073589-157073611 TGCACATGACTGCTTCCCACTGG - Intergenic
1035361511 7:158316652-158316674 GGCTCATGGGTGCTTCCTACTGG - Intronic
1038417926 8:27410999-27411021 AGACCTTTGCTTCTTCCCACAGG - Intronic
1039354001 8:36795225-36795247 GGGCCTGGGCTCCTTCCCCCTGG + Intronic
1039858312 8:41435304-41435326 GGCCCATGGCTTCCTCCCAAGGG + Intergenic
1040386672 8:46918964-46918986 GGCCCTGGGTTCCTTCCCACAGG + Intergenic
1040499620 8:47995376-47995398 GGCCTTTGGCTGCTTCATACAGG + Intergenic
1045745005 8:105408103-105408125 AGCCCTTAGATGCTTCCTACAGG + Intronic
1049154833 8:141060091-141060113 GGCTCGTGGCTGCCTCCCTCTGG + Intergenic
1049240900 8:141536962-141536984 GGCCCTGGGCTGCTCTCCTCTGG + Intergenic
1049749398 8:144276198-144276220 GGACTGGGGCTGCTTCCCACTGG - Intronic
1050600657 9:7246831-7246853 GGCCCCTGGCTCCTTGCCCCAGG - Intergenic
1053147094 9:35719127-35719149 GGCCCTTTGCTGCCTGCAACAGG + Exonic
1057191002 9:93087682-93087704 GTCCCTTGGCTGCATGCCTCAGG + Intergenic
1057746627 9:97757378-97757400 CTCCCTTTGCTTCTTCCCACTGG + Intergenic
1057784728 9:98078211-98078233 GTCCATTGACTGCATCCCACTGG - Exonic
1057948904 9:99354046-99354068 CTCCCTTGGCTGGTTCCCACTGG + Intergenic
1058560634 9:106225412-106225434 GGCCCCTGCTTACTTCCCACAGG - Intergenic
1060138689 9:121184388-121184410 AGCCCTTTGCTGTTTCCCAAGGG - Intronic
1060305370 9:122406339-122406361 GGGCCTTAGCTGCCTCCCCCCGG - Intergenic
1061195760 9:129106360-129106382 GGCCCCTGGCTGTTTCCCCAAGG - Intronic
1062538864 9:137032699-137032721 GGCCCTTAGTGTCTTCCCACAGG + Exonic
1185509314 X:651044-651066 GGCTTTTGCCTCCTTCCCACGGG - Intronic
1187242062 X:17522519-17522541 GGCCCTGGGCTGCTTCCGGATGG - Intronic
1187432397 X:19237100-19237122 GAGCCTTAGCTGCTTCCCAAAGG + Intergenic
1188330915 X:28870683-28870705 TGCCCTTGTCTGCTTGCCAGTGG + Intronic
1190072871 X:47293199-47293221 GGCCCTTTGCTGATTCCAACTGG - Intergenic
1190302635 X:49065458-49065480 GCCCCATGGCTGCTTCTCTCTGG + Exonic
1191715844 X:64192971-64192993 GGCCATGGGCTGCTTCACTCAGG + Exonic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1192318547 X:70069710-70069732 GCCACTTGGCCTCTTCCCACAGG + Intergenic
1192321116 X:70091569-70091591 GGGCCTTGGCTGGTTCCCCCTGG - Intergenic
1192810303 X:74541452-74541474 GGCCCTTTTCTGTTTCCCATAGG + Intergenic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1195671156 X:107471191-107471213 AGCCCTTGGCTGCCTCCCACAGG + Intergenic
1197761446 X:130031007-130031029 GGCCAAGGGCTTCTTCCCACAGG + Intronic