ID: 1192149275

View in Genome Browser
Species Human (GRCh38)
Location X:68701905-68701927
Sequence TGTCCCATGCTAGAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192149275 Original CRISPR TGTCCCATGCTAGAATTGGG TGG Intronic
902565163 1:17306572-17306594 TGTCCATTGTTAGAGTTGGGAGG - Intergenic
904815972 1:33198721-33198743 TGACACATGATAGAATTAGGAGG + Intergenic
912122653 1:106491692-106491714 TGTTCCCTGCCATAATTGGGAGG - Intergenic
913254878 1:116944457-116944479 AACCCCATGCTAGAAGTGGGTGG - Intronic
915084755 1:153378141-153378163 TGTCCCCTGCTATTATTGTGTGG - Intergenic
920113488 1:203603395-203603417 TTTCCCAAGCTAGTATGGGGTGG - Intergenic
920367876 1:205457449-205457471 AGACCCAAGCCAGAATTGGGAGG - Intergenic
1065801839 10:29359384-29359406 TGGCCCATGTTAGAATTCAGTGG + Intergenic
1067987136 10:51162756-51162778 TTTCCCATGCTGGAATTCAGTGG + Intronic
1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG + Intronic
1078077045 11:8171587-8171609 TTACCCAAGCTAGAATTTGGTGG - Intergenic
1079769764 11:24444629-24444651 TCTACCATTCTAGAGTTGGGAGG - Intergenic
1083277012 11:61602650-61602672 TGCCCCTTCCTAGAACTGGGAGG - Intergenic
1084755851 11:71238078-71238100 TGTCCCTTGCAAGAGCTGGGAGG + Intronic
1086989587 11:93288337-93288359 AGCCCCATGCCAGATTTGGGAGG + Intergenic
1098242866 12:68486324-68486346 TGTCCCAGGCTAGAGTACGGTGG - Intergenic
1098398663 12:70050022-70050044 TGTAACATGCTAGAACTGTGTGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104184848 12:126420507-126420529 TGTCCCATGCTAAAATGGGCTGG - Intergenic
1108745918 13:53393597-53393619 TGTCCCATGGTAGAGGTGGTAGG + Intergenic
1113418706 13:110152819-110152841 TGACCCATGTTAGAATGGGTTGG - Intronic
1124456355 15:29846301-29846323 GGTGCCATCCTAGAACTGGGGGG - Intronic
1125388112 15:39159993-39160015 TGTGCCATGCTAGAGTTTTGAGG - Intergenic
1129464429 15:75716012-75716034 TGTCCCATGCTTGGCTGGGGAGG - Intergenic
1129715858 15:77850051-77850073 TAACCCATGCTACAATTTGGAGG + Intergenic
1129720817 15:77877000-77877022 TGTCCCATGCTTGGCTGGGGAGG + Intergenic
1131234490 15:90684088-90684110 CATCCCATGCTGGGATTGGGAGG + Intergenic
1133982679 16:10645179-10645201 TGTCTCATGCAATAACTGGGGGG - Intronic
1134195421 16:12155840-12155862 GGTCCCATGCTAGAGATGGCTGG + Intronic
1139372518 16:66477767-66477789 TTTCCCATGATGGAGTTGGGGGG - Intronic
1143844706 17:9765281-9765303 TTTTCCATGTTAGAACTGGGTGG - Intergenic
1147769207 17:42856262-42856284 TCTCCCCTGCTAGGATTTGGTGG + Exonic
1151682031 17:75627368-75627390 TGACCCATGCTAGAATCTGGGGG + Exonic
1157092070 18:44648475-44648497 AGTGCCATGCTGGAACTGGGTGG + Intergenic
1157285165 18:46372644-46372666 GGTCTCCTGTTAGAATTGGGGGG + Intronic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
927873901 2:26641638-26641660 TGTCCCAGGTTACAATGGGGTGG - Intergenic
929111827 2:38411399-38411421 TTTCCCAGGCTAGAATGCGGTGG + Intergenic
930031458 2:47060633-47060655 TGTCCCATGCTGTGATTTGGTGG + Intronic
933390895 2:81665276-81665298 TGTCCCAGGCTAGAGTACGGTGG - Intergenic
943155940 2:184176923-184176945 TATGCCATGCTACAATTAGGAGG - Intergenic
945790292 2:214295749-214295771 TGGCCCAGGCTGGAATTCGGTGG - Intronic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
948025179 2:234770894-234770916 TGTCCCAACCTAGGAGTGGGGGG + Intergenic
1170314416 20:15027947-15027969 TGTCCCATGCTGGAATGTGGTGG + Intronic
1170745793 20:19097942-19097964 CATCCCATGCTTGATTTGGGGGG + Intergenic
1171953506 20:31441620-31441642 TGGCTCATGCTGGAATTGGTGGG - Intronic
1174534239 20:51238396-51238418 TGTCCCCTGCTAGAACATGGAGG + Intergenic
1178405345 21:32318674-32318696 TGTAACATGGTAGAATTGGAGGG + Intronic
1178727323 21:35065395-35065417 TGTCCCAGGACAGAAGTGGGAGG - Intronic
1179034096 21:37745130-37745152 TGGCCCAGGCTAGAGTTTGGTGG + Intronic
1180990733 22:19934194-19934216 TGTCCCAGGCTTGGAGTGGGTGG - Intronic
1183036101 22:35142127-35142149 TGTTCCATGCTAGAACATGGTGG + Intergenic
953193225 3:40709055-40709077 TTTTACATGCTAGAATGGGGTGG + Intergenic
954195022 3:48991199-48991221 TGTCACCTTCTAGAACTGGGAGG + Intronic
961519580 3:127459224-127459246 TGTACCAGGCTCGAATTGAGCGG + Intergenic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
967186526 3:186949092-186949114 TTTCCAAGGCTAGAATTGGCAGG - Intronic
970038546 4:11769612-11769634 TGACCCATCCAAGAATTGGCAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
979136687 4:117118837-117118859 CGTCCTCTGCTAGCATTGGGTGG - Intergenic
986245345 5:6001983-6002005 TGTACTATGCTATAATGGGGTGG - Intergenic
988081354 5:26418429-26418451 TCACCCAAGCTAGAATTTGGGGG - Intergenic
993756202 5:91733478-91733500 TGGCCTATGGTGGAATTGGGAGG + Intergenic
995483561 5:112616264-112616286 TGTGACATAGTAGAATTGGGAGG - Intergenic
998343510 5:141440143-141440165 TGGCCCAAGCTATAATTGGGGGG - Intronic
998536661 5:142938924-142938946 TGGCAGATGCTAGAATTAGGTGG + Intronic
999620682 5:153469875-153469897 TTTCCCATGCCAGACTTGGGAGG + Intergenic
1003450029 6:6222303-6222325 TGTTCCATGCTGGAAAAGGGTGG + Intronic
1004196869 6:13513141-13513163 TTTCCCATCCTAGAGTCGGGTGG - Intergenic
1006379142 6:33687666-33687688 TGAGCCAGGCTAGAATTTGGGGG + Intronic
1007715214 6:43851793-43851815 CTTCCCATGCCAGAATGGGGTGG + Intergenic
1007767278 6:44168307-44168329 TCGCCCATGCTAGAGTTCGGTGG + Intronic
1008194723 6:48504334-48504356 TGTTTCATGGTAGGATTGGGAGG + Intergenic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1011408272 6:87038975-87038997 TGTCCCATGCATGACTCGGGGGG - Intergenic
1012330153 6:97975070-97975092 TGTCCCATGATATAGTTTGGTGG + Intergenic
1030066683 7:105664947-105664969 TGTCACATGCAGGAATTTGGGGG - Intronic
1031079016 7:117240557-117240579 TGCCCCATGATCTAATTGGGAGG - Intergenic
1034356678 7:150456009-150456031 AATCCCATGCAAGAAGTGGGAGG + Intronic
1035041386 7:155930529-155930551 TGTCCCATGCAATATTTAGGAGG - Intergenic
1042747497 8:72122986-72123008 TGTCTCCTGGTTGAATTGGGGGG + Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044722670 8:95166091-95166113 GGTCCCATTCTAGAATGGGAAGG - Intergenic
1047030370 8:120872302-120872324 TGTCCTATGCTTTTATTGGGTGG + Intergenic
1052282705 9:26751494-26751516 TGTCTCTTGCAAGATTTGGGAGG + Intergenic
1052525320 9:29610519-29610541 TGTCCCTTGCTAAAAGTGGAGGG - Intergenic
1052961306 9:34299506-34299528 TGGCCCAGGCTAGAATGCGGTGG - Intronic
1053130166 9:35610061-35610083 CTTCCCATGGTAGAATGGGGTGG - Exonic
1053250084 9:36567079-36567101 TGTGCCAGGCTAGAGCTGGGAGG - Intergenic
1189298738 X:39937195-39937217 TGTCCCAGGCTAGAATTCTGGGG - Intergenic
1192149275 X:68701905-68701927 TGTCCCATGCTAGAATTGGGTGG + Intronic
1198867504 X:141140036-141140058 TGTCTCATTCTTGAAGTGGGAGG + Intergenic
1202015982 Y:20407110-20407132 TGTCCCATGCCCTATTTGGGGGG - Intergenic