ID: 1192149792

View in Genome Browser
Species Human (GRCh38)
Location X:68705173-68705195
Sequence TGGAGCAACTGCAGCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192149790_1192149792 -2 Left 1192149790 X:68705152-68705174 CCTTGGGGGCAAGAAAACTAATG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 342
1192149788_1192149792 0 Left 1192149788 X:68705150-68705172 CCCCTTGGGGGCAAGAAAACTAA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 342
1192149789_1192149792 -1 Left 1192149789 X:68705151-68705173 CCCTTGGGGGCAAGAAAACTAAT 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 342
1192149782_1192149792 25 Left 1192149782 X:68705125-68705147 CCTGGGACTGGGTTGGGGGCAGG 0: 1
1: 1
2: 13
3: 101
4: 885
Right 1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192149792 Original CRISPR TGGAGCAACTGCAGCAGAGC AGG Intronic
900186011 1:1333604-1333626 AGGAGCAGCAGCAGCACAGCCGG - Exonic
900408314 1:2502050-2502072 GGGAGCAGCTGCAGCTGGGCTGG + Intronic
900642949 1:3695967-3695989 TGGTAGAACTGCAGCAGAGCAGG + Intronic
900669477 1:3841876-3841898 TGAAGCAAGTGCAGTAGGGCAGG - Intronic
901053706 1:6438724-6438746 TGGTGCAGCTGCAGCTGAGGAGG - Intronic
901142203 1:7042444-7042466 TGGAGCAGCTGGAGCAGGGCTGG + Intronic
903322899 1:22553276-22553298 TGGAGGAACTGCTGCTGAGGTGG - Intergenic
903779791 1:25813980-25814002 TGGAGGAACTGCAGGTGAGCGGG + Exonic
904163382 1:28537315-28537337 TGTAGCAACTATAGCAGAGGAGG + Intronic
904272805 1:29361720-29361742 GGGAGAAACTGCAGCAGACATGG + Intergenic
904433985 1:30482399-30482421 TGGAGGAGCTGGAACAGAGCTGG - Intergenic
904946623 1:34203706-34203728 TGAAGCACCTGTAGCAGGGCTGG + Intronic
905177102 1:36143919-36143941 TGGAGCACCTGCTGCACAGCAGG + Intronic
906105127 1:43286922-43286944 TGGTGTAGCTGCAGCAGAGGAGG - Intergenic
907164596 1:52399029-52399051 TGGAGCAATCCCAGAAGAGCGGG - Intronic
907937336 1:59054356-59054378 TGGAGGGACAGCAACAGAGCTGG - Intergenic
909548850 1:76876447-76876469 TGGAGTGACTTCAGCAGAGGAGG - Intronic
910235194 1:85028378-85028400 TGGGGAAACTGCATCATAGCAGG + Intronic
910804060 1:91173143-91173165 TGCAGAAACTGCAGTAGAGCAGG - Intergenic
913078634 1:115361291-115361313 TGGAGCCACTGCTGCAGAAGGGG + Intergenic
914816566 1:151067374-151067396 GCAAGCAACTGCAGCAGACCAGG + Exonic
914863352 1:151404952-151404974 AGGAGCAACTGAAGCTGAGTGGG - Exonic
915279249 1:154810968-154810990 TAAAGCAACTGAAGCAGAGAAGG - Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
917256602 1:173122983-173123005 TGGAGACACAGCTGCAGAGCAGG - Intergenic
920356322 1:205375909-205375931 TGGAGCAAAAGCAGCAGAGAAGG - Intergenic
923565530 1:235073467-235073489 TGGTGCAGCTCCAGCAGAGAAGG - Intergenic
924138579 1:240998527-240998549 TGGAGCAGCAGCAGCAGAGGCGG + Intronic
924208615 1:241742236-241742258 TGGAGGAAATGCAGCAGAAAGGG - Intronic
924854710 1:247864775-247864797 AGGAGCAACGGCAGCTGAGGCGG + Exonic
1062830499 10:602308-602330 TGCAGCAAATGCAGCTGAGAAGG + Intronic
1065131265 10:22622498-22622520 AGGTGCGATTGCAGCAGAGCAGG - Intronic
1065983795 10:30930082-30930104 GGGAGCAGGTGCCGCAGAGCAGG + Intronic
1065999284 10:31089141-31089163 TGGAGCAACTGCTGCCTGGCCGG - Intergenic
1066324390 10:34342212-34342234 TTGAGCAACTGCTGCAGAGCAGG + Intronic
1067090476 10:43263800-43263822 GGGAGGTGCTGCAGCAGAGCCGG + Intronic
1067248759 10:44569907-44569929 TGGAGCTGCAGCAGCAGAGGTGG + Intergenic
1068086743 10:52382693-52382715 TGCAGCATCTGCAGCAGATCAGG - Intergenic
1069019224 10:63466391-63466413 CGCAGTAACAGCAGCAGAGCAGG + Intergenic
1069461499 10:68599429-68599451 TGCAACAGCGGCAGCAGAGCAGG - Intronic
1069991025 10:72316288-72316310 TGGGGAAACTGAGGCAGAGCAGG + Intergenic
1070339164 10:75480950-75480972 TGGAACAACTGCATCAAAGATGG + Intronic
1071709895 10:88039719-88039741 TTGAGCAAATGCAGGAGGGCAGG + Intergenic
1072297114 10:94020123-94020145 TAGAGCAACTGCAACATTGCTGG - Intronic
1073253986 10:102139363-102139385 TAAAGCAACAGCAGCAGAGATGG + Exonic
1073291135 10:102413891-102413913 AGGACCATCAGCAGCAGAGCTGG + Exonic
1074811522 10:117109989-117110011 TGGAGAAACTGAATCATAGCTGG + Intronic
1075165789 10:120067132-120067154 AGCATCAACAGCAGCAGAGCTGG + Intergenic
1076767159 10:132642433-132642455 TGGAGAAACTGCAGCTATGCTGG - Intronic
1076945475 10:133646223-133646245 TTGAGTAACTGCAGCTGGGCTGG + Intergenic
1077721958 11:4638498-4638520 TGGAGTAACAGCAGCAGCACTGG + Intergenic
1078460920 11:11514783-11514805 AGGAGCAACCAGAGCAGAGCAGG + Intronic
1078752978 11:14182524-14182546 TGGAGGAACTGAAGCAGAGATGG - Intronic
1078908249 11:15707437-15707459 GTGAGCAACTCCAGCAGAGATGG - Intergenic
1079243219 11:18735348-18735370 TGGGGGACCTGCAGCAGAGAGGG + Intronic
1079284952 11:19120229-19120251 TGGAGAGACTGCAGCAGGGTTGG + Intronic
1079343082 11:19629125-19629147 TGGAGACACTGAGGCAGAGCGGG - Intronic
1080316832 11:30959131-30959153 AGGACCAACTGCAGCAGTGAAGG + Intronic
1081682551 11:45018413-45018435 CGGAGCAAGGGCAGCAGAGGAGG + Intergenic
1082003006 11:47404059-47404081 TGGACAAACTTCAGCAGAGCTGG - Intergenic
1083335506 11:61919430-61919452 AGGAGCAAGTTCAGCTGAGCAGG - Intronic
1084675129 11:70629718-70629740 GGGAGCACCTGCTGCAGAGCTGG + Intronic
1085538709 11:77245570-77245592 TGGAGCAACTGAGGTAGAGCTGG - Intronic
1085798257 11:79563629-79563651 TGAAGAAACTGAAGCAGAGAGGG + Intergenic
1087868924 11:103266973-103266995 CGGAGTATGTGCAGCAGAGCTGG - Intronic
1089222715 11:116888180-116888202 TCTAGAAACTCCAGCAGAGCTGG - Intronic
1090458466 11:126869392-126869414 TGGAGACACTGCAGGAGAGTGGG - Intronic
1090805335 11:130198785-130198807 TGGAGAACCTGTAGCAGGGCAGG + Intronic
1092184718 12:6470420-6470442 TGCAGCAGCTGCAGCAACGCGGG - Intronic
1092415750 12:8289321-8289343 TGGAGCAAATCAATCAGAGCTGG + Intergenic
1092674418 12:10900465-10900487 TGGAGCACCTGCTTTAGAGCAGG + Intronic
1094260790 12:28496402-28496424 TGGAGCCATAGGAGCAGAGCAGG + Intronic
1095243619 12:39891185-39891207 TGGAGAGACTGGGGCAGAGCTGG - Intronic
1096180960 12:49550065-49550087 TGCAGCAGCTGCAGGTGAGCAGG - Exonic
1096597341 12:52704756-52704778 TGGAGACTCTGCAGCAGAACCGG + Intergenic
1100851738 12:98719158-98719180 TGGAACAACTAGAGAAGAGCAGG - Intronic
1101332173 12:103766030-103766052 TGAAGAAACTGCAGCCGAGTTGG + Intronic
1101364154 12:104056002-104056024 TGGAGCAATTGCTGCAGTTCAGG - Intronic
1103391532 12:120577397-120577419 TGGTACAGCTGCAGGAGAGCAGG + Exonic
1104015105 12:124956855-124956877 TGAAGCAACTGCAGGAGAACCGG - Exonic
1104958494 12:132477205-132477227 CGCAGCAGCTGCAGCAGGGCTGG - Intergenic
1105424352 13:20282428-20282450 TGGACCCACTGCTGCAGACCTGG + Intergenic
1106529954 13:30581474-30581496 TTGCGCTACAGCAGCAGAGCTGG + Intronic
1107044018 13:35976301-35976323 TGGAGCAGCTGCAGCCCAGATGG + Intronic
1107896877 13:44974248-44974270 TGTAGCAACTGAGCCAGAGCTGG + Intronic
1109801920 13:67391012-67391034 TGGAGAAAAGACAGCAGAGCAGG + Intergenic
1110357364 13:74583094-74583116 TGGAGCAACTGTAACAAGGCTGG - Intergenic
1111853347 13:93604993-93605015 TGAAGCAATTGCAGCATAGCAGG - Intronic
1112140686 13:96638407-96638429 TGAAGAAACTGCAGTAGAGAGGG - Intronic
1112374160 13:98823480-98823502 TGAAGCAGGTGCAGCAGAGGCGG + Intronic
1113888108 13:113671585-113671607 TGGAGCACCTGCACCAGAGGCGG + Exonic
1114412868 14:22517288-22517310 TTGTGCATCAGCAGCAGAGCTGG + Intergenic
1114519385 14:23323385-23323407 TGGTGCAACAGCAGAAGAGCTGG + Exonic
1116945963 14:50835495-50835517 CGCAGCAACTGAAGCATAGCAGG + Intergenic
1117431141 14:55662918-55662940 TGCAGCAGCAGCAGCAGCGCTGG + Intronic
1117552396 14:56849393-56849415 TGGGGAAAAGGCAGCAGAGCAGG - Intergenic
1118605901 14:67503316-67503338 TGGAACAACTGAAGCAGGGGTGG + Intronic
1118849062 14:69571116-69571138 TGGGGCAACTGCTGCAGAAGGGG + Exonic
1119029914 14:71183881-71183903 TTGAGAAACTGAAGAAGAGCTGG + Intergenic
1119336594 14:73838444-73838466 TTCAGCAACTGTAGCAGCGCAGG + Intergenic
1120486182 14:85116072-85116094 TGGAGGAACTCCAGCACAGACGG - Intergenic
1121295643 14:92819820-92819842 TGGAGCGACTGAAGCAGGTCAGG + Exonic
1122843371 14:104477347-104477369 TGGAGCAAGAGCCGCAGGGCAGG + Intronic
1122871325 14:104640408-104640430 GGGGGCAGCTGCAGCAGAGGGGG - Intergenic
1123816111 15:23981035-23981057 GGGAGCAACTACAGCAGACAGGG + Intergenic
1124118138 15:26866931-26866953 TGGAGAAACTTCAGCAGAACAGG + Exonic
1124216936 15:27815330-27815352 CGGTGCATCTGCAGCAGGGCTGG + Intronic
1125668871 15:41455387-41455409 TGCAGCAACTTCAGTGGAGCTGG + Intronic
1126869781 15:52975740-52975762 TGGAGACACTGCAGCAGATTTGG + Intergenic
1127489093 15:59445241-59445263 TGAAGCAACTACAGAAGTGCAGG + Intronic
1128548306 15:68581845-68581867 TGGAGAAGCAGCAGCAGAGAAGG - Intronic
1128719752 15:69939761-69939783 TGGGGCAGCAGCAGCAGAGAGGG + Intergenic
1129235456 15:74221275-74221297 TGGAGCAGGGGCAGGAGAGCAGG + Intergenic
1129275495 15:74442715-74442737 TGGAGCTGCTGCAGGGGAGCTGG - Intergenic
1129386797 15:75200883-75200905 TGGAGCAGCTGGAGCTGAGGAGG - Intronic
1131691459 15:94831857-94831879 CGGAGCAACTGGAGAAGAGTCGG + Intergenic
1131972123 15:97903573-97903595 AGGAGCATCTACAGGAGAGCAGG + Intergenic
1132867938 16:2103079-2103101 AGGAGCCTCTGCACCAGAGCTGG + Intronic
1133484510 16:6206376-6206398 GAGAACAACTGGAGCAGAGCAGG - Intronic
1133910220 16:10059161-10059183 TGGAGCAGCTGCAGATGTGCTGG + Intronic
1134523831 16:14930035-14930057 AGGAGCCTCTGCACCAGAGCTGG - Intronic
1134549072 16:15130900-15130922 AGGAGCCTCTGCACCAGAGCTGG + Intronic
1134711422 16:16328520-16328542 AGGAGCCTCTGCACCAGAGCTGG - Intergenic
1134719273 16:16371819-16371841 AGGAGCCTCTGCACCAGAGCTGG - Intergenic
1134948153 16:18340066-18340088 AGGAGCCTCTGCACCAGAGCTGG + Intergenic
1134955407 16:18380173-18380195 AGGAGCCTCTGCACCAGAGCTGG + Intergenic
1135111248 16:19692277-19692299 TGGAGCATCTGCCGCAGGCCGGG - Intronic
1139022731 16:62771374-62771396 TGAAGCAGCTGCATCAGAACAGG + Intergenic
1139448484 16:67013331-67013353 TGGAGGAAGTGCAGCTGAGCAGG + Intergenic
1140615340 16:76656225-76656247 TGGAACAATTCCAGCAGAGTAGG + Intergenic
1141405299 16:83787432-83787454 AGGAGTAAATGGAGCAGAGCGGG - Intronic
1141593883 16:85086036-85086058 TGGAGAAACCGCAGCTGAGCAGG + Intronic
1141669419 16:85484017-85484039 TGGGGAAACTGAGGCAGAGCTGG + Intergenic
1141959930 16:87398740-87398762 TGGAGAACCAGCAGCAGTGCTGG + Intronic
1143033396 17:3980721-3980743 TGGAGCAGCTGAAGGAGAGCTGG + Intergenic
1143387230 17:6538268-6538290 CTGAGTAAGTGCAGCAGAGCAGG + Intronic
1145221800 17:21095638-21095660 GGGAACAACTTCAGCAAAGCTGG - Intergenic
1145273663 17:21417747-21417769 TGGAGGAACTTCAGCAGTGGAGG - Exonic
1145311850 17:21705189-21705211 TGGAGGAACTTCAGCAGCGGAGG - Intergenic
1147645202 17:42029066-42029088 TGCAGGAACTGCTGCAGAGATGG + Exonic
1148126888 17:45241848-45241870 TCTCGCACCTGCAGCAGAGCCGG + Exonic
1148438447 17:47699467-47699489 TGAAGCAGCTGCAGGAGACCCGG + Exonic
1148480698 17:47957853-47957875 TCCAGGAGCTGCAGCAGAGCAGG - Exonic
1149087398 17:52734549-52734571 TACAGCAACTGGGGCAGAGCAGG + Intergenic
1149610125 17:57953874-57953896 TGGAGCGTGTGCAGCAGGGCTGG - Intronic
1151033431 17:70770383-70770405 TATAGCAGCTGCAACAGAGCTGG - Intergenic
1152191223 17:78889109-78889131 CTGAGCAGCTGCAGTAGAGCTGG + Intronic
1152885820 17:82848812-82848834 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1152885898 17:82849240-82849262 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1153241026 18:3031398-3031420 GGGAGCAACTTCAGCAAAGTTGG - Intergenic
1153532544 18:6063130-6063152 TGTAGCAACTTGTGCAGAGCTGG - Intronic
1153914309 18:9732358-9732380 TGCACCCACTGCAGCAGGGCAGG + Intronic
1155548865 18:26943633-26943655 TGGAGAAACTGTAGCTAAGCTGG + Intronic
1156160981 18:34357960-34357982 TGGGGTAATGGCAGCAGAGCAGG - Intergenic
1156945333 18:42822616-42822638 TGGAGTAATTAGAGCAGAGCTGG - Intronic
1160507044 18:79433001-79433023 GGGAGCAAACGCAGCAGGGCGGG - Intronic
1160820912 19:1057398-1057420 AGTAGCAACAGCAGGAGAGCAGG - Exonic
1161208396 19:3054030-3054052 TGGAGCTGCTGCTGCAGGGCGGG + Exonic
1161687027 19:5707962-5707984 TGGAGAACAAGCAGCAGAGCTGG - Intronic
1162034651 19:7932463-7932485 TGGGGCAGCTGCAGCCGGGCAGG + Intronic
1162456610 19:10788773-10788795 TGGAACAGCTGGACCAGAGCAGG + Intronic
1163527937 19:17832616-17832638 TGAAACAGCTGCAGCACAGCGGG - Exonic
1163983483 19:20923529-20923551 TGGAGGAACTGGGGCCGAGCTGG - Intronic
1166225202 19:41390790-41390812 TGGAGGATCAGCAGCAGAGCTGG - Intronic
1166532568 19:43551975-43551997 GGGAGAAACTGCAGCGGCGCAGG + Intronic
1166748308 19:45152394-45152416 TGGAGGACCGGCAGCAGACCGGG - Exonic
1167109118 19:47448411-47448433 TGGAGGAAGGGCTGCAGAGCGGG + Intronic
1167346091 19:48946588-48946610 AGGAGCAACTGCAGCTGCCCAGG + Intergenic
1167466574 19:49653532-49653554 TGGGGCGGCTGCAGCAGTGCTGG - Exonic
1167924239 19:52810335-52810357 CGGTGCAACAGCAGAAGAGCTGG + Intronic
1168085494 19:54042710-54042732 TGGAGCACCTGGAACAGAGCTGG - Intronic
1168269164 19:55240293-55240315 TGCAGCAGCTGCGGGAGAGCGGG + Exonic
925637782 2:5958789-5958811 TGGATCAATTGCTGGAGAGCTGG + Intergenic
926401321 2:12500000-12500022 TGGAGGGGCGGCAGCAGAGCAGG - Intergenic
926716977 2:15932467-15932489 TGGAGCCCCTGCAGGAGGGCTGG + Intergenic
927711085 2:25326734-25326756 TGGAGAAGCTGCAGCAGCACAGG - Intronic
927827353 2:26317868-26317890 TGGAGCTCCAGCAGCGGAGCTGG + Intronic
928180102 2:29062752-29062774 TGGAGCCACTCCAGCAGTGAGGG - Exonic
929829786 2:45337725-45337747 AGGCGCATCTGCAGCACAGCTGG + Intergenic
930971089 2:57396968-57396990 TGGTCCAACTGCAGCCTAGCAGG - Intergenic
931282307 2:60804872-60804894 TGGAGCGGCTGCAGCAGGGAAGG - Intergenic
931779061 2:65564348-65564370 GGCAGCACCTGCAGCAGAGCTGG + Intergenic
932255334 2:70280418-70280440 GAGAGCCACTGGAGCAGAGCTGG - Exonic
933453623 2:82492549-82492571 TGGAACAACTGCAGGAGGGTAGG + Intergenic
933989155 2:87621277-87621299 GGGAGGGAATGCAGCAGAGCAGG - Intergenic
934087319 2:88520684-88520706 TGGCTCTGCTGCAGCAGAGCAGG + Intergenic
935060766 2:99605581-99605603 TGGGGCAGCTGCAGCAGTGAGGG + Intronic
936156681 2:110051517-110051539 TGGAGGAAGTTCAGCACAGCAGG - Intergenic
936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG + Intergenic
936304688 2:111329549-111329571 GGGAGGGAATGCAGCAGAGCAGG + Intergenic
937126199 2:119476429-119476451 AGAAGAAACTGCAGCAGAGTCGG + Intronic
937224162 2:120358641-120358663 TGGAGCAACTGAGGCTGAGGGGG + Intergenic
937866355 2:126754266-126754288 TGGTGCAACTGCAGCTCAGGGGG + Intergenic
937867873 2:126767544-126767566 AGCAGCAACTGCTGCAGAGGGGG - Intergenic
938402493 2:131005023-131005045 TGGAACAGCTGCAGCAAAGGGGG + Intronic
938632679 2:133185402-133185424 TGGAGCAAAAGAAGCATAGCTGG - Intronic
942054835 2:172172708-172172730 GGGCGCAACTGCAGCCGTGCCGG + Intergenic
942444657 2:176070123-176070145 TGGAGCTGCTGAGGCAGAGCTGG - Intergenic
943953473 2:194158654-194158676 TGGAAAAACTGGAACAGAGCAGG - Intergenic
944325260 2:198396900-198396922 GGGAGCCACTGCAGCAGGGCTGG + Intronic
944508656 2:200442414-200442436 TTGAGCAGCAACAGCAGAGCTGG - Intronic
944513226 2:200484838-200484860 TGGAGAAACTGAAGCACAGAGGG - Intergenic
945928399 2:215829508-215829530 TGGAGTAACAGAAGCAGAACTGG - Intergenic
946326207 2:218985775-218985797 GGGAGCAACGGCTGCAGGGCCGG - Intergenic
947436850 2:230080307-230080329 TGGAGAAACTGAACCAGAGAGGG + Intergenic
948100013 2:235365855-235365877 AGGAGCACTGGCAGCAGAGCTGG + Intergenic
948484397 2:238271311-238271333 TGGAGCATGTGCAGTGGAGCAGG - Exonic
1169198180 20:3694421-3694443 TGGAGCAGCCGCAGCTGGGCCGG + Exonic
1169198886 20:3698007-3698029 TGGAGCAGCTGCAGCCTGGCGGG + Exonic
1169584729 20:7068454-7068476 TGTAATAACTGCAGAAGAGCTGG - Intergenic
1170080257 20:12467382-12467404 TTGAGGAACTGCAACAGAGTGGG - Intergenic
1171243127 20:23587444-23587466 TGGAGCTCCTCCAGCAGAGCAGG + Intergenic
1171369839 20:24654792-24654814 AGGAGCAGCTGCAGCAGTGAAGG + Intronic
1172443267 20:34980027-34980049 GGGAGCAGCTGTAGCAGTGCGGG + Intronic
1172744299 20:37194714-37194736 TTGTGCAACTGGAGCAGAGATGG + Intronic
1173249949 20:41359041-41359063 TGGAGCAGCTGCAGCTTAGCTGG - Exonic
1173435768 20:43031005-43031027 TGTTGCAACTGCATCACAGCTGG - Intronic
1173853672 20:46235594-46235616 TGGAGCTACTGCGGCTGAGATGG - Intronic
1174358327 20:50012857-50012879 TGCAGAACCTCCAGCAGAGCCGG + Intergenic
1174480155 20:50825544-50825566 TGGAGAAGCTGCATCAGAGAAGG + Intronic
1175116133 20:56683812-56683834 TGGAGCAGAAGCAGCAGAGAGGG + Intergenic
1176008985 20:62881692-62881714 TGAAGCAGCTGCAGCCGAGCGGG - Exonic
1176191191 20:63810903-63810925 AGGAGCTCCAGCAGCAGAGCCGG + Intronic
1178337297 21:31754832-31754854 TGGAGCTCCTGCAGGACAGCGGG + Intergenic
1180224771 21:46385887-46385909 TGGAGGTGCTGCAGCAGAGGCGG + Exonic
1181045503 22:20212289-20212311 AGGAGCAACTTCAGCAGGACGGG - Intergenic
1181345185 22:22214884-22214906 TGGAGAAGCTGGAGCAGAGGTGG - Intergenic
1181432188 22:22888287-22888309 TGGGGGTCCTGCAGCAGAGCTGG + Intronic
1181439315 22:22927615-22927637 GGTAGCATCTTCAGCAGAGCCGG - Intergenic
1182160927 22:28120694-28120716 GGGAGAAACAGCAGAAGAGCTGG + Intronic
1182360247 22:29742288-29742310 TGGAGCCACTGCTGCAAAGTGGG + Intronic
1182714004 22:32340690-32340712 TGGAGGAACAGCAGCGGGGCTGG + Intergenic
1183059491 22:35327374-35327396 TGGAGCTGCTGCAGGTGAGCAGG + Exonic
1183156667 22:36081104-36081126 TGGTGCATCAGAAGCAGAGCTGG + Intergenic
1183184767 22:36285599-36285621 TGGAGCCACCACGGCAGAGCTGG - Intronic
1183512869 22:38246067-38246089 TGGGGCAGCTGTAGCAGCGCAGG + Exonic
1183951822 22:41356794-41356816 AGGAGCACCTGTCGCAGAGCCGG - Exonic
1184106097 22:42368409-42368431 TGGAGAAACTGCAGCTGAGGCGG - Intergenic
1184128806 22:42505124-42505146 TGAAGCAGCTGCTGCAGAGGTGG + Intergenic
1184137601 22:42558439-42558461 TGAAGCAGCTGCTGCAGAGGTGG + Exonic
1184840189 22:47048095-47048117 TGCAGCAACAGCAGTGGAGCTGG - Intronic
1185269809 22:49924165-49924187 GGGAGCACCTGCTGCACAGCAGG + Intronic
949143983 3:672932-672954 TGGAGCAAAGGGAGCAAAGCTGG + Intergenic
949210441 3:1492650-1492672 TGGAGCAACTTGGGCAGATCTGG - Intergenic
949564043 3:5228856-5228878 TGGAGCTACAGCAGCAGTGGTGG + Intergenic
950493706 3:13321246-13321268 AGGAGCATCTGCCACAGAGCAGG - Intronic
950705523 3:14777572-14777594 TGCAGCAACAGCAGCAGCCCAGG + Intergenic
950953286 3:17023988-17024010 AGGATGAACTGCAGCAGAGAGGG - Intronic
954386831 3:50248528-50248550 AGGAGCAGCTCCAGCAGAGAAGG - Intronic
954509069 3:51106098-51106120 TGGAGCAAGTGAAGCCTAGCGGG - Intronic
954611634 3:51947443-51947465 AGGAGCAAAGTCAGCAGAGCAGG + Intronic
955706571 3:61733600-61733622 TTTAGCAACTAAAGCAGAGCAGG + Intronic
958052489 3:88366126-88366148 AGGAGCAAATGCTACAGAGCAGG - Intergenic
961615282 3:128174536-128174558 TGGAGAAGCTGCAGCACAACAGG + Intronic
962252410 3:133843903-133843925 AGGAGCTACTTCAGCAGCGCTGG + Intronic
963107276 3:141658099-141658121 TGGAGCTTCTGCAGCAGCTCTGG + Intergenic
963110224 3:141682382-141682404 TGGAGCAAGTCCTTCAGAGCTGG + Intergenic
964117783 3:153154832-153154854 TGGAGCCACTGCTGCAGAAGGGG + Intergenic
964590589 3:158359489-158359511 TGCGGCTGCTGCAGCAGAGCAGG + Intronic
966257584 3:177935047-177935069 CGGAGCAATTGCAGCAAAGCAGG + Intergenic
968479720 4:827689-827711 AGGAGCAGATGGAGCAGAGCAGG - Intergenic
968734966 4:2290563-2290585 GGGGGCAGGTGCAGCAGAGCAGG + Intronic
969139098 4:5053305-5053327 TGGAGCATGTGCAGGTGAGCAGG + Intronic
969937447 4:10696328-10696350 TGGAGCAGATGCAGCAAAGGGGG - Intergenic
970863502 4:20732183-20732205 TGGAGGAACTGTTTCAGAGCAGG + Intronic
971400157 4:26268743-26268765 AGGGGCAGCTGCAGCAGAGGCGG + Intronic
971519897 4:27536343-27536365 TGCAGCAACTTGAGTAGAGCTGG - Intergenic
975794688 4:77994756-77994778 TGGGGCAACTGCAGTTGTGCAGG + Intergenic
976077599 4:81317189-81317211 TGGAGTACCTACAGGAGAGCTGG + Intergenic
976808499 4:89074531-89074553 TTGAGCAGCTGCAACAGAGATGG + Intronic
980074391 4:128278910-128278932 TTGAAAAACTGCAGCAGGGCTGG + Intronic
980322845 4:131302180-131302202 TGCAGCAACTGCCTCAGTGCAGG - Intergenic
980615302 4:135213442-135213464 TGGAGAAAGGGCAACAGAGCTGG - Intergenic
983352707 4:166613542-166613564 TGGAGTAGCTGCAACAGAGCTGG + Intergenic
985165677 4:187091347-187091369 AAGAGCAGCTGAAGCAGAGCAGG - Intergenic
985672122 5:1212498-1212520 TGGAGCACCTGCAGCCTGGCCGG - Intronic
986097645 5:4575386-4575408 TGAAACACCTGCAGCAGAGGAGG - Intergenic
986284098 5:6347348-6347370 TGGAGCTGCCGCAGCAGAGAGGG - Intergenic
986468131 5:8047621-8047643 TTGAACAATTGCAGCAGAGATGG + Intergenic
986671928 5:10150338-10150360 TGAAGCAACTGCAGGAGAAGAGG + Intergenic
987160082 5:15132870-15132892 GGGAGCAGCTGCAGTGGAGCTGG - Intergenic
988759370 5:34297004-34297026 TGGAGCTACAGCAGCTGAGATGG - Intergenic
988789222 5:34592048-34592070 TGGACTAACTGCAGCAGAAGGGG - Intergenic
990741973 5:58921568-58921590 GGGAGCAAAGGCAGCAGAGCAGG - Intergenic
991957364 5:72008327-72008349 AGGAGCAACTGCAACAGAGAAGG - Intergenic
992464651 5:76991765-76991787 TGGAGCAGCTGAAGCTGACCAGG + Intergenic
992678965 5:79134111-79134133 GGGAGGGACTGCAGGAGAGCAGG + Intronic
993987628 5:94616653-94616675 TGGGGCAAATGCAGAAGATCTGG - Intronic
995248922 5:109967009-109967031 TGGAGCAGTGGCAGCAGAGGGGG - Intergenic
995559698 5:113367438-113367460 TGGAGCAAGTCCAGAAGAGTAGG - Intronic
995758901 5:115544049-115544071 TCTTGCAACTGCAGGAGAGCTGG + Intronic
996451420 5:123629402-123629424 GGCAGCAGCAGCAGCAGAGCAGG - Intergenic
997447711 5:133953526-133953548 TGGAACATCGGCAGCAGTGCCGG + Intergenic
998435867 5:142108639-142108661 CGGAGCAACTACACCAGGGCCGG + Exonic
998761651 5:145439034-145439056 TTGAGCAACTGCAACATTGCTGG - Intergenic
999304656 5:150511819-150511841 TGGAGAAACTCCCGCACAGCTGG + Intronic
1001513037 5:172337040-172337062 TGGAGCAACGGGAGCTGAGGTGG - Exonic
1001916989 5:175570006-175570028 TGGAGAATCAGCAGGAGAGCAGG - Intergenic
1003510817 6:6778793-6778815 TGGAACAACAGCAGAAGAGCTGG + Intergenic
1004424081 6:15496106-15496128 TGGAGCAGCAGAAGCAGAGGTGG - Intronic
1005993717 6:30919530-30919552 TTATGCCACTGCAGCAGAGCTGG - Intronic
1006543739 6:34761953-34761975 TTGAGTAACTGCAGCAAAGGTGG - Intronic
1006887926 6:37397744-37397766 TTGGGCAACTCCAGAAGAGCGGG - Intergenic
1007093733 6:39200682-39200704 TGGAGCAACAGCATGAGAGCTGG - Intronic
1007105460 6:39280456-39280478 GGGAGCCCCTGCAGCAGGGCTGG - Intergenic
1008062659 6:47014770-47014792 TGTAGCCACTGCTGCAGGGCAGG + Exonic
1008078592 6:47171217-47171239 GGGTGCATCTGCAGCAGAGTTGG + Intergenic
1010083142 6:71886862-71886884 AGCAGCAGCAGCAGCAGAGCCGG - Intronic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1015054258 6:128881070-128881092 TGCAGTAACTGCAGAAAAGCAGG + Intergenic
1015799332 6:137044664-137044686 AGGAGCAACAGCAGCAGCGGCGG + Exonic
1016272267 6:142302251-142302273 TGGAGCAGCGGCAGCAGAGCGGG + Exonic
1016339610 6:143049101-143049123 TGCAACAACAGTAGCAGAGCTGG - Intergenic
1016469493 6:144360453-144360475 TTGAGCCACTGCACCAGACCTGG + Intronic
1017869302 6:158473256-158473278 AGGGGCAACTTCAGCAGAACAGG - Intronic
1017945176 6:159090769-159090791 TGGAGAAACTGCAGCTGAGGCGG - Intergenic
1019619904 7:1986917-1986939 TGGAGGACCTGCAGCATGGCTGG - Intronic
1020445508 7:8262565-8262587 TGGAACACCTGCCGGAGAGCAGG - Intronic
1020806471 7:12795838-12795860 TGGAGCAACTGCAGTAGCAGAGG + Intergenic
1020894676 7:13925179-13925201 TGGAGCAACTTAATCAGAGTAGG - Intronic
1021862177 7:24916827-24916849 TGGTGTAACAGCAGCACAGCTGG - Intronic
1022526911 7:31044134-31044156 TGAAGGAACTGAAGCACAGCAGG + Intergenic
1022531959 7:31072520-31072542 TGGAGCAATGGCAGCAGGGTTGG - Intronic
1022830828 7:34064784-34064806 TGGAAGAACTGCTGGAGAGCAGG - Intronic
1022904266 7:34840680-34840702 TGGAGCATCTGCTGCCCAGCCGG + Intronic
1023511851 7:40961537-40961559 TGAAGCAAATGAAGAAGAGCTGG - Intergenic
1024246297 7:47472752-47472774 TGGAGCAAGTGCAGACCAGCAGG - Intronic
1027125572 7:75554465-75554487 TCGAGCAACTGGAGAAAAGCTGG - Exonic
1027884614 7:83888395-83888417 TGGAGAAATTGCAGTAGAGAAGG + Intergenic
1028910660 7:96203944-96203966 TGGAGAAAGTGCAACAGAGTGGG + Intronic
1030396600 7:108994485-108994507 TGGATTACGTGCAGCAGAGCAGG - Intergenic
1030464590 7:109884422-109884444 AGCATCAACAGCAGCAGAGCAGG + Intergenic
1031050036 7:116935627-116935649 TTGAGCAACTGCAGGAGCCCTGG + Intergenic
1031508216 7:122614145-122614167 TGGATGAACTGCAGAAGATCGGG + Intronic
1032000083 7:128259555-128259577 TGGAGGAACAGCTGCACAGCAGG - Intergenic
1032594098 7:133222275-133222297 TGGAGAAACTGAACCAGAGAGGG - Intergenic
1033720820 7:144058041-144058063 TGCTACAACTGCAGCAGAGGTGG - Intergenic
1033870190 7:145744739-145744761 TGGAGCAAAGGGAGCAGTGCAGG + Intergenic
1034265189 7:149777326-149777348 TGGAGCAGCTGCGGCAGGCCTGG - Intergenic
1034276628 7:149826664-149826686 TGCAGCAGCTGCAGCAGGGCAGG - Intergenic
1034432167 7:151046509-151046531 TGATGCATCTGCAGCAGTGCAGG - Intronic
1034996392 7:155579968-155579990 TTCAGCCTCTGCAGCAGAGCAGG + Intergenic
1035341150 7:158162994-158163016 AAGAGCAACTGCACCCGAGCAGG - Intronic
1037373662 8:18206014-18206036 TGGAGCATCTGTAGCAGAGCAGG - Intronic
1037510140 8:19574287-19574309 TGGAGGACCTGCAGGAGAGATGG - Intronic
1037857977 8:22385166-22385188 TGAAACAACTGCAGGAGAGGGGG + Intronic
1039161976 8:34631807-34631829 TTGAGCAGATGCAGGAGAGCTGG - Intergenic
1039646424 8:39289621-39289643 TGGAGCAACAGCAGCAGCCCAGG - Intergenic
1040822869 8:51584380-51584402 TGTAGGAACAGAAGCAGAGCAGG - Intronic
1041712661 8:60908432-60908454 TGGGTCAAATGGAGCAGAGCAGG - Intergenic
1043190672 8:77218622-77218644 TGGAGAAACTGCAGGTAAGCTGG + Intergenic
1044628890 8:94260438-94260460 TGCAGCCACAGCAGCAGCGCTGG - Exonic
1044923863 8:97193071-97193093 TGGAGCAAGTGCAGCATGGCTGG - Intergenic
1047215854 8:122875560-122875582 TGTAGCAACAGCAGCAGCGCCGG + Intronic
1050124857 9:2346511-2346533 TAAAGCTACTGAAGCAGAGCAGG - Intergenic
1050426483 9:5517021-5517043 TAGAGCAGCTGCAGCAGTGGAGG - Intronic
1050591471 9:7164603-7164625 AGGAGCACCTGCAGCACGGCGGG - Intergenic
1052194456 9:25694489-25694511 TTGAGCAACTGCAGAACAGTGGG - Intergenic
1053077921 9:35150789-35150811 TTGGGCAGCTGCAGCAGACCAGG - Intergenic
1053372134 9:37571268-37571290 TGGACCAACTGCAGCAGCAAGGG + Intronic
1055893277 9:81145878-81145900 TGGAGCCACTGCACGAGAGAGGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059097401 9:111433252-111433274 TGTGGCAACGGCAGCAGACCTGG - Exonic
1059111050 9:111558952-111558974 AGGAGCATCTGCAGGAGAGGGGG - Intronic
1059544723 9:115164781-115164803 TGGAGCAACTACAAAAAAGCAGG - Intronic
1059787316 9:117599400-117599422 ATGAGCAGCTGCAGCAGTGCTGG - Intergenic
1059820346 9:117965894-117965916 TGAAGCAGATGCAGCAGGGCAGG - Intergenic
1059960779 9:119562491-119562513 TGGAACAACTGAAGCAGCTCAGG + Intergenic
1062516280 9:136938216-136938238 TGGAGCAGCTGCCAGAGAGCTGG - Intronic
1185869011 X:3648228-3648250 TTGAGCTACCGTAGCAGAGCTGG - Intronic
1187564524 X:20435148-20435170 TGGATGAACTTCTGCAGAGCAGG + Intergenic
1187953711 X:24495294-24495316 TGGAGCAAATGAAGCAAAGGAGG - Intronic
1190319774 X:49173146-49173168 TGGAGGCACTGAAGCAGATCAGG - Exonic
1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG + Intronic
1192473610 X:71420436-71420458 TGGTGCAACAGCAGAAGAGCTGG - Intronic
1193077851 X:77374612-77374634 AAGAGCAACTGCAGGAAAGCTGG + Intergenic
1194141683 X:90217257-90217279 GAGAGCAGCTGCAGCAGAGAGGG + Intergenic
1194915706 X:99705674-99705696 TGAAGCAACTGCTTCAGAGAAGG + Intergenic
1196248230 X:113426515-113426537 CGGAGCTATTGCAGCAGACCAGG + Intergenic
1196389165 X:115190822-115190844 TGGAGCGACTGCTGCGGAGGAGG + Exonic
1197644712 X:129004916-129004938 TGGAGCAAATGGATCAGAGAAGG + Intergenic
1198697543 X:139358641-139358663 TGAAGAAACTGAAGCAGAACTGG + Intergenic
1199092260 X:143705709-143705731 TGGTGCTACTGCAGCCCAGCTGG + Intergenic
1200487435 Y:3786359-3786381 GAGAGCAGCTGCAGCAGAGAGGG + Intergenic
1201283975 Y:12363550-12363572 AGGAGCAGTTGCCGCAGAGCAGG + Intergenic
1201898254 Y:19017180-19017202 TGCAACAACAGCAACAGAGCTGG - Intergenic