ID: 1192150421

View in Genome Browser
Species Human (GRCh38)
Location X:68708899-68708921
Sequence CAGGTGGCCCGGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 217}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192150421_1192150426 -8 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150426 X:68708914-68708936 GCCACCTGGGCTTCAGCCCCAGG 0: 1
1: 1
2: 5
3: 41
4: 353
1192150421_1192150438 17 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150438 X:68708939-68708961 AATCGAGTCTACTGGGGGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1192150421_1192150439 18 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150439 X:68708940-68708962 ATCGAGTCTACTGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 145
1192150421_1192150435 12 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150435 X:68708934-68708956 AGGTGAATCGAGTCTACTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 64
1192150421_1192150440 21 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150440 X:68708943-68708965 GAGTCTACTGGGGGTGGGGGTGG 0: 1
1: 2
2: 10
3: 106
4: 859
1192150421_1192150434 11 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150434 X:68708933-68708955 CAGGTGAATCGAGTCTACTGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1192150421_1192150442 23 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150442 X:68708945-68708967 GTCTACTGGGGGTGGGGGTGGGG 0: 1
1: 3
2: 16
3: 199
4: 1276
1192150421_1192150437 16 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150437 X:68708938-68708960 GAATCGAGTCTACTGGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1192150421_1192150441 22 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150441 X:68708944-68708966 AGTCTACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 13
3: 149
4: 914
1192150421_1192150436 15 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150436 X:68708937-68708959 TGAATCGAGTCTACTGGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1192150421_1192150431 9 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150431 X:68708931-68708953 CCCAGGTGAATCGAGTCTACTGG 0: 1
1: 0
2: 1
3: 3
4: 58
1192150421_1192150433 10 Left 1192150421 X:68708899-68708921 CCATCCTCAGTCCGGGCCACCTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1192150433 X:68708932-68708954 CCAGGTGAATCGAGTCTACTGGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192150421 Original CRISPR CAGGTGGCCCGGACTGAGGA TGG (reversed) Intronic
900168465 1:1254490-1254512 CAGGAGGCCCGGCCTGCGGAGGG + Intronic
900179660 1:1305635-1305657 TAGGTCCCCAGGACTGAGGAAGG - Intronic
900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG + Intergenic
904991288 1:34594914-34594936 CACGTGCCCCTGAGTGAGGAGGG + Intergenic
905473504 1:38209841-38209863 GAGGTGGCGGGGACTGTGGAAGG + Intergenic
906101955 1:43269748-43269770 CAAGTTGCCCAGACTGAGGCTGG + Intronic
907250402 1:53134308-53134330 CAGGTGGTCCGGAACCAGGAGGG - Intronic
909798219 1:79771122-79771144 GAGGTGGCTCCGACTGAGGTTGG + Intergenic
910394070 1:86774332-86774354 GGGGTGGCCAGGACTGAAGAAGG + Intergenic
912714802 1:111975509-111975531 AAGGTGGCTGGGACTGAGGGTGG - Intronic
912812743 1:112806229-112806251 CAGCTGGCCCCTCCTGAGGAAGG - Intergenic
913195781 1:116454897-116454919 CAGGTGGACTGCTCTGAGGAGGG - Intergenic
913453453 1:119008013-119008035 CTGGTGGCCCTGACTGCGCAGGG + Intergenic
914701040 1:150134016-150134038 CAGGTGGCCAGTACTAAGGAGGG + Intronic
915289360 1:154872580-154872602 CAGGTGGCTCTGTCTGCGGATGG - Intergenic
918451766 1:184665346-184665368 CAGGTGCCACGGACTGAGCCAGG + Intergenic
920515261 1:206580543-206580565 CAGCTGGCAAGGACTGAGGATGG + Intronic
921264247 1:213409351-213409373 GAGGTGGTTCTGACTGAGGAAGG + Intergenic
922738895 1:228004929-228004951 CAGGTGGCACGGGCAGAGGATGG + Intergenic
924237549 1:242011946-242011968 CAAGTGGCCCAGACTGTGGCCGG + Intergenic
1067040720 10:42951876-42951898 CAGGTGTCTCGGACTGCGGGCGG + Intergenic
1067792804 10:49300674-49300696 CATGTGGCCTGGGCTGAGCAGGG + Intronic
1070748832 10:78951890-78951912 AAGGTGGGCCTGAGTGAGGAGGG - Intergenic
1073465542 10:103692845-103692867 CAGGGGCCATGGACTGAGGAGGG + Intronic
1073483821 10:103804236-103804258 TAGGGTGCCCGGGCTGAGGAGGG + Intronic
1074761573 10:116670433-116670455 CAGGTGGCCGGGACAGGTGAAGG + Intergenic
1075657770 10:124173419-124173441 GAGGTGGCCCCGGCTGTGGAGGG + Intergenic
1076196476 10:128522100-128522122 CAGGTGACCTGGACAGAGAAGGG - Intergenic
1076983123 11:215797-215819 CAGGTGGCCAGGACTCAGCCTGG + Exonic
1083333807 11:61911599-61911621 CGGTGGACCCGGACTGAGGAGGG - Intronic
1084326576 11:68403792-68403814 CAGGTGCCCCGACCTGGGGAAGG + Intronic
1084697172 11:70762668-70762690 CAGATGGCTCATACTGAGGAAGG - Intronic
1085176567 11:74493413-74493435 CAGCTGGCCCGGGCCGTGGAAGG + Exonic
1085522086 11:77144882-77144904 GAGCTGGCCTGGACTGAGCAGGG - Intronic
1086324254 11:85682526-85682548 CAGTTGCCCTGGTCTGAGGACGG - Intronic
1087094617 11:94307162-94307184 CAGGTGGCCCCGAGTGGGCAGGG + Exonic
1089140810 11:116282364-116282386 GAGGAGGCACGGACAGAGGAAGG - Intergenic
1091174883 11:133548871-133548893 CAGGTGGCCAGGGCTGGTGAGGG + Intergenic
1092654271 12:10668283-10668305 CAGGTCCCCCGGACTGAGAGAGG + Intronic
1095180774 12:39144882-39144904 CAGGGCGCCGGGACTGGGGAGGG + Intergenic
1096585428 12:52616686-52616708 GAGGTGGCCTGGACTGAACATGG - Intronic
1101970740 12:109310128-109310150 AAGGTGGCGCGGACCGCGGACGG + Intergenic
1102033988 12:109760614-109760636 CAGATGGCAGGGACTGAGGTGGG - Intronic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1104953791 12:132454152-132454174 CAGGAGGCCCGGGCTGGGGGTGG - Intergenic
1104980665 12:132571876-132571898 CCGGAGGCCCGGTCTGAGGAGGG + Intronic
1108498152 13:51044972-51044994 CAGGTGGCCCAGAGTGGGCAGGG + Intergenic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1114551334 14:23534355-23534377 AATGTGGCCCAGACAGAGGATGG - Exonic
1117131833 14:52695207-52695229 CCGGTGGCCGGGACTGAGTCTGG - Intronic
1117376929 14:55125740-55125762 GAGGTGGCCAGGGCTGAGGTTGG + Intronic
1118456000 14:65946153-65946175 CAGGTGTCCAGGACGGAGAAAGG + Intergenic
1119757694 14:77130526-77130548 CACAAGGCCTGGACTGAGGAAGG - Intronic
1122273626 14:100579845-100579867 GAGGTGGCCAGGCCTGAGAAAGG - Intronic
1122316936 14:100831287-100831309 GAGGTGGCCGGGACTGAGACAGG - Intergenic
1124155251 15:27219586-27219608 CAGGTGGGGAGGACTAAGGAGGG - Intronic
1124217939 15:27825187-27825209 CACGTGGCCCACACGGAGGAGGG + Intronic
1124345649 15:28919809-28919831 CAGATGTTTCGGACTGAGGAGGG - Intronic
1125365318 15:38907979-38908001 CAGTTGGCCTGGAGTGATGATGG - Intergenic
1128706813 15:69842678-69842700 CAGGTGGCCTGGCATGAGGTAGG + Intergenic
1128995229 15:72290070-72290092 TATGTGGCCCAGAGTGAGGAAGG + Intronic
1129244610 15:74271807-74271829 CAGGTGGACCTGGGTGAGGAGGG + Intronic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1130017595 15:80199817-80199839 CAGGTGGCCTGGGCTGTGGTGGG + Intergenic
1130555923 15:84922519-84922541 CAGGTGGCCCGGGCAGCGGGGGG - Intronic
1130559532 15:84947235-84947257 CAGGTAGCAAGGACTGAGGGAGG - Intergenic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132645853 16:998954-998976 CACCTGGCCAGGACTGAGGAGGG + Intergenic
1132813986 16:1817312-1817334 CTGGTGGCTAGGACTCAGGAGGG + Intronic
1133184597 16:4086457-4086479 CAGCTGGCACGGACCCAGGAGGG + Intronic
1133283426 16:4679749-4679771 CAGGTGACCCAGACTGCGGGGGG + Intronic
1135221777 16:20620796-20620818 GAGGTGGCCAGGACAGAGGTGGG + Intronic
1136108959 16:28052757-28052779 CAGGCTGCCCTGGCTGAGGAGGG + Intronic
1136141754 16:28292900-28292922 GCGGGGGCCCAGACTGAGGAGGG - Exonic
1138106366 16:54289014-54289036 CAGATGGCCCGGACAGACCAGGG - Intergenic
1138445197 16:57059106-57059128 CAGGTGCCCCTGGCTGATGATGG + Intronic
1140745340 16:77975821-77975843 CAGATGGCCAGGACTGGGGCAGG - Intronic
1141542637 16:84737884-84737906 CAGGTGGCGCTGACTGAGGGTGG - Intronic
1141636460 16:85316623-85316645 CAGGTGGCCTGGTCCGTGGAGGG - Intergenic
1141771440 16:86092122-86092144 GAGGAGGCCCGGACCGAGGAAGG + Intergenic
1141861277 16:86718122-86718144 GAGGTGGGGCTGACTGAGGATGG + Intergenic
1142213387 16:88819183-88819205 CAGGTGGCCGGGGGTGGGGAGGG - Intronic
1142340281 16:89517484-89517506 CAGGTGCCCTGGCGTGAGGAAGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1142860230 17:2756352-2756374 CAGCGGGCCAGGACTGCGGAGGG - Intergenic
1143374874 17:6461585-6461607 CAGGTGGCCTGCACTGGGCAGGG - Intronic
1143497903 17:7322902-7322924 CAGGTGGTCTGGGCTGAGGGTGG + Intronic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1146012487 17:29207025-29207047 CAGGTGCCAGGTACTGAGGAAGG - Intergenic
1146619429 17:34386084-34386106 CAAGGGGCAGGGACTGAGGATGG + Intergenic
1146789367 17:35742838-35742860 CAGGTAGCCCAGACTGGTGATGG + Exonic
1147253365 17:39166542-39166564 CAGGAGGCCAGGCCTGAGGAGGG + Intronic
1147286772 17:39408623-39408645 CAGGTGGCCTTGAATGAGAAGGG + Exonic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1148228608 17:45916917-45916939 CAGGTGGCCCAGACACTGGAGGG - Intronic
1148736587 17:49868573-49868595 CAGGTGGCCCGAGCAGAGGGTGG + Intergenic
1149597018 17:57870191-57870213 CAGGGGGCACTGACTGATGAGGG + Intronic
1152339693 17:79717124-79717146 CAGATGGCCCTGCCTTAGGATGG + Intergenic
1152473402 17:80502909-80502931 CAGGTGGCCCTGACAGAGAAGGG - Intergenic
1154348542 18:13564425-13564447 CAGGTGGCCAGGCCTCAGGGTGG + Intronic
1155250808 18:23951592-23951614 CAGTTGGCCCGGTTTGGGGAGGG + Intronic
1157699452 18:49751658-49751680 CAGTTTTCCCGGAGTGAGGATGG - Intergenic
1158423083 18:57313349-57313371 CAGGTGGCCTGGGGTGGGGAGGG + Intergenic
1161630938 19:5355089-5355111 CAGGCGGCCCGGTCTGGGGGTGG - Intergenic
1162858736 19:13489674-13489696 CAGGTGGCCAGTGCTGAGAAAGG - Intronic
1163014302 19:14444472-14444494 CATGTTGCCCTGACTGTGGATGG - Intronic
1163397149 19:17070276-17070298 CAGATGACCAGGACTGAGAATGG - Intronic
1163647310 19:18496696-18496718 CAGGTGGTGCGGACTGGGGGAGG + Intronic
1167722014 19:51185657-51185679 CAGGTGACCCTGCCTGAGGCTGG + Intergenic
1168107414 19:54173206-54173228 CAGGTGGCCCGGAGGGAGTAAGG + Exonic
925266162 2:2568005-2568027 CAGGCGACCTGGGCTGAGGACGG - Intergenic
926009996 2:9400144-9400166 CAGGTGGTCAGGACTGAGGGAGG + Intronic
926084423 2:10011815-10011837 CAGGTGGACAGGATTGAGTACGG + Intergenic
926084640 2:10012849-10012871 CAGGTGGACAGGACTGAATATGG + Intergenic
927681735 2:25144076-25144098 GAGATGGCCTGGCCTGAGGATGG + Intronic
928267143 2:29821590-29821612 AAGGTGGCCAGGGCTGGGGATGG - Intronic
928312508 2:30222542-30222564 CAGGTGGCTAGGAGTGGGGAAGG + Intergenic
929780993 2:44956840-44956862 CAGGTGGTCTGGAAAGAGGATGG + Intergenic
930036100 2:47086120-47086142 GGGGTGGCCCGCACGGAGGAGGG - Intronic
932379465 2:71269335-71269357 CAGGTGGCATGGGCTCAGGAGGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933294240 2:80471533-80471555 CAGGGAGCAGGGACTGAGGAAGG + Intronic
934640160 2:96023116-96023138 CAGCTGGCCCTGGCGGAGGAAGG + Exonic
934708966 2:96503052-96503074 CAGGTGCCCGGGACAGAGGCTGG + Intronic
934793485 2:97082284-97082306 CAGCTGGCCCTGGCGGAGGAAGG - Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937837557 2:126487724-126487746 CAGGTTGCCCTTACTGAAGATGG + Intergenic
938765849 2:134460112-134460134 CAGGTGGCCAGGACAGAGCAGGG - Intronic
940996934 2:160159606-160159628 CAGTTGGCCTGGAGTGAGTAGGG - Intronic
944114279 2:196171065-196171087 CACGCGCCCCGGGCTGAGGAGGG + Intronic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
947885527 2:233566603-233566625 TTGGTGGCCCAGTCTGAGGAGGG - Intronic
948290130 2:236818414-236818436 CAGGCAGCCCTGACTCAGGAAGG + Intergenic
948348762 2:237321333-237321355 AAGGTGGCCTGGGCTGAGTATGG - Intergenic
948386593 2:237584632-237584654 CAGGTGAGCTGGACTGGGGATGG - Intronic
1170534873 20:17330740-17330762 CAGGTGGCCAGGTCTGAGGCTGG + Intronic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1174450257 20:50615690-50615712 CAGGTGACCTGGACTTGGGATGG - Intronic
1174466986 20:50725261-50725283 TAGGGGGCCGGGACTCAGGATGG - Intergenic
1175327774 20:58141747-58141769 CAGGTGGCCAGGCCTGTGGGTGG - Intergenic
1175917533 20:62433622-62433644 CAGACGGGCCGGACAGAGGAGGG + Intergenic
1176274765 20:64258126-64258148 GAGGTGGCTTTGACTGAGGACGG + Intronic
1179820420 21:43934003-43934025 CAGCTGGCCATGACTGAGAAAGG - Intronic
1180801647 22:18634666-18634688 AAGGTGGCGGGGACTGAGGGCGG + Intergenic
1180852891 22:19030205-19030227 AAGGTGGCGGGGACTGAGGGCGG + Intergenic
1181025357 22:20124501-20124523 CATGTGGCCTGGACTGGGCATGG + Intronic
1181160479 22:20957177-20957199 CAGGAAGCCCGGACTGAGCGCGG - Intergenic
1181220076 22:21360595-21360617 AAGGTGGCGGGGACTGAGGGCGG - Intergenic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181693919 22:24583467-24583489 CAGGTGGGCCGTACTCAGGCCGG - Intronic
1183931326 22:41237719-41237741 CAGGTGGCCCAGGCCGGGGAAGG + Exonic
1184296176 22:43526951-43526973 CAGGTGTGCAGGACTCAGGATGG - Intergenic
1184858351 22:47158701-47158723 CAGGTGGCCCGTCCTGTGGAAGG + Intronic
1184954645 22:47877687-47877709 TGGGTGGCCCGGCCAGAGGACGG - Intergenic
1185066224 22:48632990-48633012 CCAGGGGCCAGGACTGAGGACGG - Intronic
952280590 3:31919422-31919444 AAGGTGGCCAGGTCTTAGGAAGG + Intronic
952747409 3:36794275-36794297 CAGGTGCCCCTGTCTGTGGATGG - Intergenic
952825019 3:37517519-37517541 CAGCTGGCTCTGACTGGGGATGG + Exonic
952858319 3:37791713-37791735 CATGTGGGCAGGACTGTGGAGGG - Intronic
954806375 3:53223310-53223332 CAGGTGGCCCTGCCTGTGAACGG + Intergenic
956004292 3:64762200-64762222 CAGGTGGCCCTGAGTGGGGAAGG - Intergenic
958487766 3:94733259-94733281 CAGGCAGCCAGGGCTGAGGAAGG + Intergenic
960039543 3:113136019-113136041 CAGGAGGCCCTGCCAGAGGAAGG + Intergenic
960875926 3:122295431-122295453 CAGGAGGCCTGAGCTGAGGAAGG - Intergenic
960914193 3:122680584-122680606 TAGGGGGCCCGGAGTTAGGAGGG + Intergenic
961034923 3:123635491-123635513 CAGGTGGCACTGACTCAGGCTGG - Intronic
961051802 3:123752872-123752894 CAGGGGGCCAGGACTGAGTACGG + Intronic
961455745 3:127023086-127023108 CAGCTGGCCTGGGCTCAGGAGGG + Intronic
966593972 3:181710661-181710683 AAGGCGGCCGGGACTGGGGAAGG - Intergenic
968472870 4:790005-790027 CAGGTGGCCACGCCTGAGGGCGG + Intronic
968472900 4:790081-790103 CAGGTGGCCACGCCTGAGGGCGG + Intronic
968872260 4:3247990-3248012 CAGTTGGTCAGGCCTGAGGAGGG + Exonic
969527798 4:7712851-7712873 CAGGTGGGCCGGCATGAGGCTGG + Exonic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
969665073 4:8552766-8552788 CATGTGCCCCAGACTGAGGAAGG - Intergenic
970993585 4:22239624-22239646 CCGGTGGCCAGGACTGTGTAGGG + Intergenic
971127575 4:23771273-23771295 CAGATGGTGCTGACTGAGGATGG - Intronic
971451474 4:26805475-26805497 CAAGAGGCACGGCCTGAGGAAGG - Intergenic
973685568 4:53366119-53366141 GAGGAGGCCGGGAGTGAGGAAGG + Intergenic
976544352 4:86317366-86317388 GAGGTGGGCAGGACTAAGGAGGG - Intronic
977022905 4:91777661-91777683 CAGGTGTCACTGACTGAGGCTGG + Intergenic
977716635 4:100190511-100190533 CAGGTGGGCGGGCCTGAGCAGGG - Intronic
985423929 4:189810711-189810733 CAGGTGTTCCGGGCTGAGGCCGG + Intergenic
986009058 5:3695474-3695496 CAGGTGGTCTGGATTGAAGATGG - Intergenic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
992388796 5:76311811-76311833 CTGGTGGCAGGGACTGGGGACGG - Intronic
994184975 5:96807388-96807410 CAGCTGGCTCGGGCTGAGGAGGG - Intronic
999730968 5:154476534-154476556 CGGCTGCCCCGGACTGGGGATGG - Intronic
1001651544 5:173319505-173319527 CTGGTGGCCCAGACTTAGGGAGG - Intronic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1002015071 5:176314740-176314762 CAGATGGCCCTGACTCATGATGG + Intronic
1002191106 5:177478108-177478130 CAGGTGGCCCTGCCACAGGAAGG - Intergenic
1003020543 6:2505260-2505282 CTGATGGCCTGGACTGGGGAAGG - Intergenic
1003622661 6:7714863-7714885 CTGGTGGCCTGGGCTGGGGAAGG + Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1007666518 6:43516745-43516767 GAGCTGGCCCGGAATGGGGAGGG - Exonic
1019361939 7:609134-609156 CAGGTGCCCGGGACTGGGGCTGG - Intronic
1019506045 7:1391988-1392010 CAGGAGGCCAGGACAGACGATGG - Intergenic
1019534919 7:1523847-1523869 CAGGTGGCCCCGGCTGAGGTCGG - Intergenic
1020204796 7:6105587-6105609 CAGGTGGCTAGGCCTGGGGAGGG - Intronic
1023806866 7:43878599-43878621 CCTGTGGCCCGGGCTGAGGACGG + Exonic
1024228251 7:47344800-47344822 CAGGTGGGCTGAACGGAGGATGG + Exonic
1024633900 7:51271127-51271149 CAGGTGACACGCACTGAGGCTGG - Intronic
1025849978 7:65237459-65237481 CAGGGGCCCAGGACAGAGGAGGG + Intergenic
1029519411 7:101050704-101050726 CAGGAGGGCGGGAGTGAGGATGG + Intronic
1032457377 7:132083630-132083652 CAGGTGGCCAGGGCTGAGCCTGG - Intergenic
1032508995 7:132456791-132456813 CAGGTGGGCTGGGCTGAGGGTGG - Intronic
1033261908 7:139851259-139851281 CAGGAGGCCTGGACTGTGGCTGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034411622 7:150945265-150945287 CAGGAGGCCCTGACCGTGGAAGG - Exonic
1036646190 8:10612509-10612531 CCGAGGGCCCGGAGTGAGGAGGG - Exonic
1038406284 8:27325261-27325283 CAGGTGGAGTGGACAGAGGATGG + Intronic
1038562239 8:28590424-28590446 CAGATGTCCCCGACTTAGGATGG + Intergenic
1038765865 8:30427109-30427131 CACGAGGCCCAGGCTGAGGACGG - Intronic
1039985685 8:42445788-42445810 CAGGTGGGCTGGGCTGAGGTGGG - Intronic
1040717534 8:50275660-50275682 CTGGGGGCCCGGACTTAGGTGGG - Intronic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1047667056 8:127103852-127103874 CTGGTGGCCAGAACTGAGTATGG + Intergenic
1048963937 8:139601572-139601594 CAGGCGGCCCCAACAGAGGACGG - Intronic
1049001169 8:139826420-139826442 CAGCTGGCCAGGGCTGAGCATGG - Intronic
1049004724 8:139847524-139847546 CTGGAGGCCCGGCCTGGGGATGG + Intronic
1049616071 8:143576241-143576263 CAGGTGTCCTTGACTGAGGCGGG - Intronic
1051818154 9:21133860-21133882 AAGGAGGCTCTGACTGAGGAAGG - Intergenic
1053284366 9:36840718-36840740 ATGGTGGCCCGGACTGAGTGAGG - Intronic
1056243148 9:84669121-84669143 TAGGTGGCCCGGAATGGGGGCGG + Intronic
1057042882 9:91860066-91860088 CAGTTGGCATGGTCTGAGGAAGG + Intronic
1057529472 9:95831476-95831498 CAGGTAGCCCTGGCTGAGGTGGG - Intergenic
1060205943 9:121682940-121682962 TAGGGGGCCCTGAATGAGGATGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062562239 9:137146737-137146759 GAGGAGGCCCAGGCTGAGGAGGG + Intronic
1203790832 EBV:150811-150833 CAGGTGGACAGGGCCGAGGAGGG - Intergenic
1203659232 Un_KI270753v1:25899-25921 CAGGAGGCCTGGACAGAGCATGG - Intergenic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187004173 X:15215635-15215657 CAGGTGGCTGGGGCTGATGATGG - Intergenic
1187932996 X:24311245-24311267 CCTGTGGCCCTGGCTGAGGAGGG + Intergenic
1188340580 X:28996124-28996146 TAGTTGCCCAGGACTGAGGAAGG - Intronic
1192150421 X:68708899-68708921 CAGGTGGCCCGGACTGAGGATGG - Intronic
1197262353 X:124332769-124332791 GAGGAGGCCAGGACTGAGCAAGG + Intronic
1197344974 X:125319971-125319993 GAGGAGGCCAGGACTGAGCAAGG + Intergenic
1199871302 X:151901187-151901209 CAGATGGCTAGGACTGAGAATGG + Intergenic
1200090263 X:153632720-153632742 CAGCTGGCCTGGCCTGAGGCGGG - Intergenic