ID: 1192151110

View in Genome Browser
Species Human (GRCh38)
Location X:68712964-68712986
Sequence CAGTATGTGCAGCTTTTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192151106_1192151110 18 Left 1192151106 X:68712923-68712945 CCAAAAGAGCATGTGAGTGGCTT 0: 1
1: 0
2: 0
3: 26
4: 262
Right 1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG 0: 1
1: 0
2: 3
3: 15
4: 217
1192151104_1192151110 24 Left 1192151104 X:68712917-68712939 CCGAGGCCAAAAGAGCATGTGAG 0: 1
1: 0
2: 0
3: 16
4: 234
Right 1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG 0: 1
1: 0
2: 3
3: 15
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192151110 Original CRISPR CAGTATGTGCAGCTTTTTGA AGG Exonic
901350538 1:8591850-8591872 CAGCATGTGCAGATTTCTGTGGG - Intronic
901372930 1:8816310-8816332 CAGTATCTGTTGCTTTTTTAAGG - Intronic
903620042 1:24691387-24691409 AAGTCAGTGGAGCTTTTTGAGGG + Intergenic
905855544 1:41309248-41309270 CACTATGCCCAGCATTTTGAAGG - Intergenic
905990921 1:42335889-42335911 CAGTAGGTGGAGCGTTTAGAAGG + Intergenic
906281890 1:44560079-44560101 AAGTAGCTGCAGCTTTTTCAAGG - Intronic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
910847072 1:91613864-91613886 CAGTATTTGCAGTGATTTGAGGG - Intergenic
912062015 1:105685942-105685964 CAGACTGTGCAGCTCTTTTAAGG + Intergenic
914973840 1:152338877-152338899 CAATTTTTTCAGCTTTTTGAAGG - Intergenic
915626485 1:157117276-157117298 CTGTTTGTGCTGCTCTTTGAGGG + Intergenic
915854841 1:159372066-159372088 CAGTATGTGTAGCTTTATGATGG - Intergenic
916551399 1:165853171-165853193 CAGTAGGTTCAGCTCTTTGTGGG - Intronic
918379257 1:183938041-183938063 CAGTTTGTGTAGGTATTTGAGGG - Exonic
920493239 1:206435349-206435371 CAGCATGTCAAGGTTTTTGAAGG + Intronic
920707383 1:208263973-208263995 CTCTATGTGCAGCCTTTTGCAGG - Intergenic
922321003 1:224486696-224486718 TAGTTGGTGCAGCTTTTTAAAGG + Intronic
924938528 1:248792809-248792831 CAGTATGTGCAGTATTCTCAAGG - Intergenic
924941818 1:248817424-248817446 CAGTATGTGCAGCCTTGTGAGGG + Intronic
1067692759 10:48512702-48512724 CTGTTTGTGCAGCCTTTGGATGG - Intronic
1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG + Intronic
1070072491 10:73103093-73103115 TAGGATGTGGACCTTTTTGAGGG - Intergenic
1070349895 10:75582087-75582109 GAGTATCTGCAGCTTTTTCAGGG + Intronic
1070785595 10:79160476-79160498 CAGTCTGCACAGCTCTTTGAGGG + Intronic
1071273351 10:84029393-84029415 CAGTCTGTGATGCTTTGTGATGG + Intergenic
1071937347 10:90546679-90546701 CAGTATCTCCAGCTTTATCAGGG - Intergenic
1072351716 10:94563776-94563798 CAGTGTGCCCAGCTTTTTGTTGG + Intronic
1073382478 10:103090091-103090113 CAATATGGGCACCATTTTGAGGG - Exonic
1073822149 10:107275962-107275984 CATAATGAGCAGCTTTTTGTTGG + Intergenic
1074268727 10:111931291-111931313 CAGTTTGTGGTGCTTTTTAATGG - Intergenic
1074426175 10:113353494-113353516 CAAAATGTGCCCCTTTTTGAGGG - Intergenic
1075192992 10:120328647-120328669 CTGGATGGTCAGCTTTTTGAAGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078309332 11:10223296-10223318 AGTTATGTGCAGATTTTTGACGG - Intronic
1081422441 11:42886379-42886401 AAATATGTACAGCTTTTTTATGG + Intergenic
1082098448 11:48151121-48151143 CAGTTTGTGGTGCTTTTTTATGG - Intronic
1084331212 11:68431799-68431821 CAGTTAGTGCAGCGTTCTGACGG - Intronic
1086226211 11:84513099-84513121 CAGAATGTGCAGGTTTGTGCAGG - Intronic
1088339692 11:108749198-108749220 CCGTATGTCTAGATTTTTGAAGG + Intronic
1090165432 11:124541957-124541979 CAGAATGTAGAGCTTTTTCAAGG - Intergenic
1090399415 11:126439513-126439535 CAGTATCTGCATTTTTTTAAAGG - Intronic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1091917746 12:4281657-4281679 CAGGCCGTGCAGCTATTTGATGG + Intronic
1095088398 12:38083172-38083194 CAGTGTGTGTAGCTCTTTCAGGG - Intergenic
1096637294 12:52968448-52968470 CAGTATGTGTATCTATTTTAGGG - Intergenic
1099350666 12:81565044-81565066 CAGTATCTCCAGCTTTATCAGGG - Intronic
1099374466 12:81882047-81882069 CAGGATGTGCAGGTTTGTTATGG + Intergenic
1099778017 12:87159178-87159200 AATTATGTGCAGCTTTCTGTGGG + Intergenic
1101335327 12:103791549-103791571 CAGGATGTGGAGTTTATTGAGGG - Intronic
1104908134 12:132226298-132226320 CAGTATGTGCAGCGTGTATATGG - Intronic
1105505571 13:21006684-21006706 GAGTAAGTGGATCTTTTTGATGG - Intronic
1106731082 13:32542012-32542034 CAGAATGTGCTACTTTTTGTAGG + Intergenic
1107055709 13:36101142-36101164 CAGTTTGTGCAGCGTATTGAGGG + Intronic
1107847915 13:44537091-44537113 CAGTAAGTGCATTTTTTTCATGG + Intronic
1111282385 13:86043725-86043747 CAGAATGTTCTGCTTTTTAATGG - Intergenic
1112323216 13:98426013-98426035 CAGTATGAGCACCTTCTTTAAGG - Intronic
1112832207 13:103466943-103466965 CAGTATGTGGAGCTGTGTGTGGG + Intergenic
1115109826 14:29808092-29808114 TAGCATGTGATGCTTTTTGATGG + Intronic
1115216196 14:31016311-31016333 CAGTTTGTTCACCTTTTGGAGGG - Intronic
1115258949 14:31433159-31433181 CAGCATGTGATGCTGTTTGATGG - Intronic
1115370322 14:32606248-32606270 CAGTATGTTCAATTTTTTAATGG + Intronic
1118574654 14:67230216-67230238 CAGTGTATGCTGCCTTTTGAAGG - Intergenic
1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG + Intronic
1118919400 14:70136354-70136376 CAGTATGTGGAGCTTTGTTACGG + Intronic
1119965915 14:78915661-78915683 CCCTCTGTGCAGCTTCTTGATGG + Intronic
1121824380 14:96998748-96998770 CAGCATGTGCTGCTGTTTGCTGG + Intergenic
1125324255 15:38520239-38520261 CATTATGCACAGCTTTTAGAAGG - Intronic
1131571416 15:93541051-93541073 CAGGATCTGGAGCTTCTTGAAGG - Intergenic
1135278310 16:21132433-21132455 CAGGATGTGTACCTTCTTGAAGG + Intronic
1140933132 16:79646480-79646502 CAGTAAGTGGAGATCTTTGAGGG + Intergenic
1142486214 17:249113-249135 CAGTATGTGGTGTTTTCTGAAGG - Intronic
1150425104 17:65070960-65070982 CAGTATATGCAACTTTGTGTTGG - Intergenic
1153337963 18:3944031-3944053 CAGTATGTGGTACTTTTTAATGG + Intronic
1153452997 18:5250320-5250342 AAGTATATGCAGCCTGTTGAAGG - Intergenic
1153487173 18:5611310-5611332 CAGTATGTCCTTCCTTTTGAAGG - Intronic
1153612494 18:6900134-6900156 AAGTATGTTCAGCTTCTTGCTGG - Intronic
1155082203 18:22421366-22421388 CACCATGTGCAGGTTTTTGTGGG - Intergenic
1155201162 18:23519077-23519099 CAATATGTGCATCTTTTTACAGG - Exonic
1156264149 18:35470736-35470758 CAGTCTGTTCAGGTTTTTGTTGG - Intronic
1157366447 18:47068989-47069011 CAATTTTTGCAGCTTTTTAAAGG - Intronic
1157376660 18:47173682-47173704 CAGTTTGTGCTGCTTTGTTATGG - Intronic
1159237044 18:65689410-65689432 CAGAATGTCCTTCTTTTTGAAGG + Intergenic
1159533697 18:69688096-69688118 CAGTATGTGATGGTTTTTCATGG - Intronic
1160748774 19:723921-723943 TACTACGTGCAGCTTTCTGAGGG + Intronic
1164240672 19:23385377-23385399 CTGTATTTGCAGTTTTGTGATGG + Intronic
1164427101 19:28151207-28151229 CAGTTTGTGGAGCTTTATTAAGG - Intergenic
1164730354 19:30499216-30499238 CAGTATCTGCTCTTTTTTGAGGG + Intronic
1166746021 19:45142238-45142260 CAGGATGTGCAGCCTGTTGGGGG + Intronic
1167751722 19:51384718-51384740 CAGTCTGTGGGGCTTTTTTATGG + Intronic
1168598932 19:57702612-57702634 CAGTGTGAGCAGCCTGTTGATGG + Exonic
925795965 2:7543209-7543231 CAGGATATGCAGATTTTTTATGG + Intergenic
926929564 2:18023554-18023576 GAGTGTCTGCAGCTTTTTCACGG + Intronic
930999452 2:57762733-57762755 CAGTATGTGGTGATTTTTAAAGG - Intergenic
931107204 2:59069362-59069384 CAGCATGAGCAGATGTTTGAGGG - Intergenic
934104563 2:88683698-88683720 CAGTTTGTGAAGCATTTAGATGG - Intergenic
935734213 2:106093838-106093860 CAAAATCTGCAGTTTTTTGAGGG + Exonic
938592872 2:132756351-132756373 AAGTTTCTGCAACTTTTTGAGGG - Intronic
941540241 2:166773149-166773171 TAGTATGTGAAACTTTTTAAAGG + Intergenic
941624064 2:167810767-167810789 CAGTATGTGCAGAGTTTTCCTGG - Intergenic
943215492 2:185028382-185028404 CAGAATGAGCAGGTCTTTGAAGG - Intergenic
944797431 2:203202282-203202304 TAGTATGTGCAGTTTTTCTAAGG + Intronic
945273790 2:207968090-207968112 TAGTATGTGCATTGTTTTGAGGG + Intronic
945899110 2:215518129-215518151 GAATTTGTGCAGCATTTTGATGG - Intergenic
946819607 2:223616451-223616473 CAGTAGAGGAAGCTTTTTGAGGG - Intergenic
946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG + Intergenic
1171374967 20:24686161-24686183 AAGTGTGTGCAGGTTTTTGCGGG + Intergenic
1173256233 20:41395892-41395914 ACGTATGTGCTGCTTCTTGACGG + Intergenic
1175644266 20:60657955-60657977 CAGTATGTCCAGGTTTTGGGGGG + Intergenic
1176903064 21:14467032-14467054 CAGTTTGTGTAGCTTTTGGTTGG + Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177903964 21:26952530-26952552 CAATAAGTGCAGCTTCTTCAGGG - Intronic
1178213601 21:30567871-30567893 GAGTATTTGCAGCTTTATTAAGG - Intergenic
1181470078 22:23133046-23133068 GATTATGTTCAGCTTTTAGAAGG - Intronic
1182146470 22:27999727-27999749 CAGTATGTAGAGCTTCTTAAAGG - Intronic
1182991854 22:34775891-34775913 CACTATGTGCAGGGTTTTTATGG - Intergenic
1183339045 22:37268118-37268140 CACAATGTGCAACTTTTTTAAGG + Intergenic
1183776075 22:39966626-39966648 CAGCATGTGGAGTTTTATGATGG + Intronic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
951225527 3:20116653-20116675 CTGTGAATGCAGCTTTTTGATGG + Intronic
951304991 3:21048618-21048640 CAGGAAATGCAGCTTTTAGATGG - Intergenic
951809095 3:26679733-26679755 CAGAATGTGGAGCTTTATGAGGG + Intronic
953502610 3:43452426-43452448 CAGTATGTGGTCCTTTGTGATGG + Intronic
953572719 3:44084255-44084277 CAGTGTGTTAGGCTTTTTGAGGG - Intergenic
954632443 3:52054958-52054980 CAGCAGGGGCAGGTTTTTGAAGG + Intronic
955917869 3:63924777-63924799 AAGTATGGACAGCTTTTTAAAGG + Intronic
956019718 3:64921291-64921313 AATTATGTGCCTCTTTTTGAAGG - Intergenic
956967219 3:74475780-74475802 CAGTATGTGCAGTACTTTCAAGG + Intronic
957941215 3:87006753-87006775 CAATTTTTTCAGCTTTTTGAAGG + Intergenic
958168560 3:89909477-89909499 CAGTATGACCAGGTTTTTGCTGG + Intergenic
958706833 3:97666329-97666351 CAGTTTGTGCTGCTTTGTTATGG - Intronic
958757044 3:98261492-98261514 CAGCATGAGTAGGTTTTTGAGGG - Intergenic
958984307 3:100762794-100762816 CAGTATGTGAAACTTTATGGTGG - Intronic
960869065 3:122231035-122231057 GAATTTTTGCAGCTTTTTGAGGG + Intronic
961613276 3:128158393-128158415 TAGCATGTGAAGCTGTTTGATGG - Intronic
963552904 3:146746706-146746728 CACTATATGCAACTTTTTAATGG - Intergenic
964130091 3:153276876-153276898 CAGTATTTGGGGCATTTTGAAGG - Intergenic
964698980 3:159542339-159542361 AAGCATGTGCAGATTTTTGGTGG - Intronic
965425660 3:168519341-168519363 CATTATGTCCTGCTTTTTGAAGG - Intergenic
966087610 3:176088179-176088201 GAGTATGTGCAGCTTCTCTAGGG + Intergenic
966347060 3:178991569-178991591 CAGAATGTGCAGGTTTGTTAAGG - Intergenic
968670959 4:1851318-1851340 CAGCAAGTGCAGCTTTAAGATGG + Intronic
969415767 4:7057235-7057257 TAGTATGTATATCTTTTTGATGG + Exonic
969542621 4:7803200-7803222 CAGTATGTGAAGTTATTTGAGGG - Intronic
970892501 4:21063262-21063284 CAGTTTGTGCAACTTTGTTATGG + Intronic
971289558 4:25324314-25324336 CAGTATGTACTGTTTTTTAAGGG + Intronic
971857062 4:32057881-32057903 GAGTGTCTGCAGCTTTTTCAGGG + Intergenic
972017339 4:34263268-34263290 GAGTGTCTGCAGCTTTTTTAGGG + Intergenic
974134463 4:57797528-57797550 TGATGTGTGCAGCTTTTTGAAGG - Intergenic
974283219 4:59826385-59826407 CAGTATTACCAGCTTTTTGCTGG - Intergenic
978223885 4:106310539-106310561 CAGTTTGTTCAGCTTCTTTAGGG - Intronic
978928650 4:114283341-114283363 AAGTATGTGCAGTGTTTTGAAGG - Intergenic
979539350 4:121863196-121863218 CAGTAAGTATAGCTTTGTGAAGG - Exonic
980504063 4:133691739-133691761 CAGAATGTGCAGGTTTGTTATGG - Intergenic
983313760 4:166099459-166099481 GACTATGTGGAGCTCTTTGATGG + Exonic
983785306 4:171722202-171722224 CAGTATCTGCAGCTTCATCAGGG + Intergenic
986163809 5:5254971-5254993 CTGAATCTGCTGCTTTTTGAAGG + Intronic
986221709 5:5774577-5774599 CAGTCTGTGGTGCTTTGTGATGG - Intergenic
986258668 5:6123682-6123704 GAGTGTCTGCAGCTTTTTCAAGG + Intergenic
987069313 5:14321166-14321188 GAGTTTGAGCAGCTGTTTGAAGG + Intronic
988278793 5:29117103-29117125 CTGTATGTGCAGATCTTTTATGG + Intergenic
990149407 5:52799947-52799969 CACTCTGTGCACCTTCTTGAGGG + Exonic
990565726 5:57026584-57026606 AAATATGTGCAGCTTATTGTAGG + Intergenic
991197329 5:63951603-63951625 CTGTATGTTTAACTTTTTGAAGG - Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993814133 5:92519801-92519823 CATAATGTGGATCTTTTTGAGGG + Intergenic
994822607 5:104673109-104673131 CAGTATTAACAGCTTTTTGGTGG - Intergenic
995377898 5:111498144-111498166 ATGTATGTGCAGCTTCTAGATGG - Exonic
995482975 5:112611110-112611132 GGGTATGTGTAGTTTTTTGAGGG + Intergenic
995926661 5:117383039-117383061 GAGTATGTGCAGCGTGTTTATGG + Intergenic
996111341 5:119570033-119570055 CACTATGTTCTGCTTTTGGATGG + Intronic
997024950 5:130048557-130048579 CTGTCTCTGCAGATTTTTGAAGG + Intronic
997257973 5:132443812-132443834 CAGTAAGTACAGCTTATTGAAGG - Intronic
998097766 5:139406532-139406554 AAGAATGTGCAGCTTTGTGAAGG - Intergenic
998696524 5:144646832-144646854 CAGGATATGCAGCCATTTGATGG + Intergenic
1000986840 5:167869736-167869758 CTGCATGTGCAGCTTTTAGAGGG - Intronic
1004080752 6:12390309-12390331 CAGTCTGTCCATCTTTTGGAGGG + Intergenic
1005174682 6:23031353-23031375 TAGTATGTATATCTTTTTGATGG - Intergenic
1008047509 6:46866320-46866342 CTGAATGTGCCACTTTTTGAAGG + Intronic
1008059776 6:46984977-46984999 CAGGCTGTGCAGCCTTTCGAGGG - Intergenic
1011331167 6:86207880-86207902 CAATATCTGCAGCTTTATTAGGG + Intergenic
1011334423 6:86244349-86244371 CTGTAATTGCAGCTGTTTGAAGG - Intergenic
1015350133 6:132209133-132209155 CACTACATTCAGCTTTTTGATGG + Intergenic
1017833853 6:158158284-158158306 CAGTGTGTGCCACTTTTTGGTGG + Exonic
1018384006 6:163286283-163286305 CAGTATGTACAGCTGTTTTTAGG + Intronic
1019730786 7:2628262-2628284 CAGTTTGTGGAGCTTTGTCACGG - Intergenic
1028528310 7:91809893-91809915 CAGTATGTGGGGAATTTTGAAGG + Intronic
1030232103 7:107219501-107219523 CAGGATTTGCTTCTTTTTGAAGG - Intronic
1031253313 7:119414729-119414751 CACCTTGTGCATCTTTTTGAAGG - Intergenic
1031307570 7:120150798-120150820 CAGTATCTGCTTCTTTTTTAAGG - Intergenic
1031772222 7:125858354-125858376 CAGACTGTGCAGATTCTTGAAGG - Intergenic
1032107585 7:129047127-129047149 GGGTGTATGCAGCTTTTTGATGG - Intronic
1034516161 7:151581881-151581903 CAGTATCTGCAGCATTTTGGGGG - Intronic
1035222237 7:157412907-157412929 CAGTACGTTCAGTATTTTGAGGG - Intronic
1035994288 8:4528700-4528722 AATTATGTACAGCTTTTTGTAGG + Intronic
1036948227 8:13115585-13115607 CAGTATGCACAGCTTTATGAAGG - Exonic
1037376215 8:18232738-18232760 CAGTATCTGCTTCTTTTTTAAGG - Intergenic
1038521977 8:28241757-28241779 CAGTATGTGGTACTTTGTGATGG + Intergenic
1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG + Intergenic
1041732844 8:61079640-61079662 CAGACTGTGATGCTTTTTGAGGG + Intronic
1042145363 8:65722659-65722681 AAGTATGTGTAGCTTGTTGCAGG - Intronic
1043005350 8:74811583-74811605 GAGAATGTCCAGATTTTTGAAGG - Intronic
1043944563 8:86234724-86234746 AGGTATGTTCAGCTTTTGGAAGG + Intronic
1044756577 8:95468736-95468758 CAGTTTTTGCAGCTTGTTGTGGG + Intergenic
1045256271 8:100525785-100525807 CTCTACGTGTAGCTTTTTGAAGG + Intronic
1046256509 8:111704271-111704293 GAATATGTACAGCTTTTTGTAGG - Intergenic
1047377375 8:124314518-124314540 AAGTATGTGCAGCGTTGTCAAGG - Intronic
1048436130 8:134419719-134419741 CAGTGTGTCCAGCTGTTTCATGG - Intergenic
1049613410 8:143566306-143566328 GAGTGTGTGCAGCCTTGTGAAGG - Exonic
1050447796 9:5744707-5744729 CAATAGCTGCAACTTTTTGAGGG - Intronic
1051999089 9:23254540-23254562 AAATATGTGAAGCTTTTAGAGGG - Intergenic
1052299085 9:26933279-26933301 CACCATGCGCAGCTTTTTTATGG - Intronic
1055486000 9:76756875-76756897 CAGTATTTGCAGCATTTTTGGGG + Intronic
1057010817 9:91599852-91599874 CAGTATGTGAAACCTTTTTATGG + Intronic
1057560355 9:96123308-96123330 CAGTTTGTGCATCTGTTTAATGG - Intergenic
1057735358 9:97653471-97653493 CAGGATGTACAGCTTTTTGAGGG - Intronic
1059888851 9:118778536-118778558 CAGTTTGTGCTGCTTTGTTATGG - Intergenic
1060628114 9:125131623-125131645 CAGTGTATGCAGCATTTTCACGG - Intronic
1060726165 9:126007259-126007281 CAGGACGTGCAGCTCTTTGGTGG + Intergenic
1061387791 9:130300749-130300771 CCGTATGTGTGGCTTTTTGCTGG + Intronic
1187217047 X:17287312-17287334 CATTAGCTGCATCTTTTTGAAGG - Intergenic
1187361189 X:18628857-18628879 CAATATTTTCAGCTTTATGAAGG + Intronic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG + Intergenic
1190949416 X:55128207-55128229 CAGTATCTGCAATTTATTGAAGG - Intronic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1194883101 X:99278738-99278760 CAGTTTTAGCAGCTTTTTGCTGG - Intergenic
1195336740 X:103862342-103862364 CAGTATCTGCAGTGTTCTGAAGG - Intergenic
1195792516 X:108603733-108603755 CAGCATGTGGTGCTGTTTGATGG + Intronic
1196721292 X:118856609-118856631 CAGCATGTGTACCTTTCTGAAGG + Intergenic
1197911024 X:131482684-131482706 GAGTGTCTGCGGCTTTTTGAGGG - Intergenic
1199085904 X:143630638-143630660 CAGTTTGTGGAGCTTATTGAAGG + Exonic
1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG + Intergenic
1199440612 X:147863926-147863948 CAGTATGTGCTACTTTGTTATGG + Intergenic
1200342649 X:155414870-155414892 CAATATGTACAGCATTTTGTGGG + Intergenic
1200860311 Y:7984127-7984149 CAGTAGGTGCAGGTTGCTGAAGG - Intergenic
1201981280 Y:19912734-19912756 GAGTATGTGCAGTCATTTGAAGG - Intergenic