ID: 1192153176

View in Genome Browser
Species Human (GRCh38)
Location X:68724437-68724459
Sequence GGGCCTGGGTGGTGCCACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 305}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192153176_1192153194 15 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153194 X:68724475-68724497 AGCGAGGGGGAATAAGAGCAGGG 0: 1
1: 0
2: 3
3: 11
4: 249
1192153176_1192153187 -1 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153187 X:68724459-68724481 CCCTGGGCACCAAGGGAGCGAGG 0: 1
1: 0
2: 0
3: 41
4: 255
1192153176_1192153181 -9 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153181 X:68724451-68724473 CCCAGGCCCCCTGGGCACCAAGG 0: 1
1: 0
2: 5
3: 72
4: 580
1192153176_1192153195 26 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153195 X:68724486-68724508 ATAAGAGCAGGGCAGCCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 183
1192153176_1192153183 -8 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153183 X:68724452-68724474 CCAGGCCCCCTGGGCACCAAGGG 0: 1
1: 0
2: 3
3: 28
4: 291
1192153176_1192153196 27 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153196 X:68724487-68724509 TAAGAGCAGGGCAGCCCCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 194
1192153176_1192153191 2 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153191 X:68724462-68724484 TGGGCACCAAGGGAGCGAGGGGG 0: 1
1: 0
2: 2
3: 21
4: 229
1192153176_1192153193 14 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153193 X:68724474-68724496 GAGCGAGGGGGAATAAGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 273
1192153176_1192153190 1 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153190 X:68724461-68724483 CTGGGCACCAAGGGAGCGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 230
1192153176_1192153189 0 Left 1192153176 X:68724437-68724459 CCAGGGTGGCACCACCCAGGCCC 0: 1
1: 0
2: 2
3: 52
4: 305
Right 1192153189 X:68724460-68724482 CCTGGGCACCAAGGGAGCGAGGG 0: 1
1: 0
2: 1
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192153176 Original CRISPR GGGCCTGGGTGGTGCCACCC TGG (reversed) Exonic
900097391 1:945492-945514 GGGCCTGCGTGGTGCTCCCAGGG - Intronic
900102192 1:966622-966644 GGGCGTGGGTGCGGCCACCTGGG + Intronic
900496522 1:2978430-2978452 GGGCCAGGGTGGGGACACCCAGG - Intergenic
900593246 1:3469008-3469030 ATGGCTGGGTGGTGCCACCGTGG - Intronic
900606460 1:3525750-3525772 GGGCCTGGGTGCAGCCCCCTGGG - Intronic
901006463 1:6174029-6174051 GGGCCTGGGGGGAGTCACCCTGG + Intronic
901702910 1:11054926-11054948 GGGGCTGGGTGGTGGGACCCAGG - Intronic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
901811918 1:11772211-11772233 GGGGCTCAGTGGGGCCACCCAGG - Exonic
902389066 1:16092282-16092304 GTGCCTGGGTGGACCCACACAGG - Intergenic
903468352 1:23568097-23568119 GGGCCAGGGTGGGGCCGCCGGGG - Intergenic
904200623 1:28816920-28816942 GGTTCTGGGTCGGGCCACCCAGG - Intronic
904368680 1:30034850-30034872 GGGGTGGGGTGGTGCCACACGGG - Intergenic
905884411 1:41484177-41484199 GGGCCAGGCTGCTGCCACCCTGG - Exonic
907353391 1:53852144-53852166 GTGTCTGGATGGTGCCACACTGG - Exonic
907554718 1:55334151-55334173 GGGCCTCAATGGGGCCACCCTGG + Intergenic
911101796 1:94101371-94101393 GGCCCTGGGTGGTGCGGCTCCGG - Intronic
913551307 1:119919479-119919501 GGGCCTGGAGGCTGGCACCCTGG + Exonic
915349005 1:155213051-155213073 GGGCCAGGCTGGCGCCACCTGGG + Intronic
915352192 1:155233678-155233700 GGGCCAGGCTGGCGCCACCTGGG + Intergenic
916390013 1:164321316-164321338 GAGCCTGGGCCGTGCCTCCCTGG + Intergenic
919733579 1:200930066-200930088 GGGCCTGGGTGGGGCCACAGAGG + Intergenic
920045832 1:203131749-203131771 GGACCTGGGCAGTGCCACGCAGG - Intronic
920067211 1:203277402-203277424 GGGCCTGGGTGGGGGCAGCCAGG - Intergenic
922455179 1:225768522-225768544 GGGCCTGGGTGGTTTCAAACTGG + Intergenic
922774557 1:228208737-228208759 GGGCCAGCGAGGTGGCACCCTGG + Intronic
923558882 1:235023415-235023437 GGCCCTGGGGGCTGCCACCAGGG + Intergenic
923706345 1:236347892-236347914 GGTCCTGGGTGGGGACCCCCGGG + Intergenic
924044239 1:240011404-240011426 GAGCCAGGGAGGAGCCACCCAGG - Intergenic
1065589769 10:27252529-27252551 GGGCCTCGGTGGTGCACGCCAGG + Intergenic
1065928277 10:30455955-30455977 TGGCCTGGGTGCTGCCACTCAGG - Intronic
1067448824 10:46368933-46368955 GGGGCTGGGCGGAGCCACCCTGG - Intergenic
1067588548 10:47491832-47491854 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1067635674 10:47999923-47999945 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1067834981 10:49632848-49632870 GCGCGTGGGCTGTGCCACCCTGG - Intronic
1067877846 10:50020471-50020493 GGGGCTGGGTGGAGCCACCCCGG - Intergenic
1067944965 10:50683550-50683572 GGGCCTGGGTGGTGTCAGGCAGG - Intergenic
1067944994 10:50683637-50683659 GGGCCTGGGTGGTGGCAGGCGGG - Intergenic
1069706041 10:70459525-70459547 GGGGCTGGGCAGTGCCAACCTGG + Intergenic
1069728475 10:70596252-70596274 GGGGGTGGGCGGTGCCTCCCGGG - Intergenic
1069852544 10:71419399-71419421 GGGCCTGGGTGTTGCCTCCAGGG - Intronic
1069909284 10:71749861-71749883 GGGCCTGGGTGCTGAAAGCCAGG - Exonic
1070132232 10:73663930-73663952 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1070775776 10:79108930-79108952 GGGCCTGGGTGTGCCCACTCAGG - Intronic
1070866466 10:79710421-79710443 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1070866497 10:79710508-79710530 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1070880257 10:79848552-79848574 GGGTCTGGGTGGTGGCAGGCAGG - Exonic
1070880287 10:79848639-79848661 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071609450 10:87020145-87020167 GGGGCTGGGCGGAGCCACCCTGG - Intergenic
1071633376 10:87232642-87232664 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071633407 10:87232729-87232751 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071646825 10:87364860-87364882 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071646856 10:87364947-87364969 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG + Intronic
1073689997 10:105798039-105798061 GGGCCTGTGTGCTTGCACCCTGG + Intergenic
1074955574 10:118385123-118385145 GGGCATGGGAGGTGTGACCCAGG + Intergenic
1075748564 10:124744517-124744539 GGGCCTGGGCCGCGCCACCGCGG + Intronic
1076096328 10:127737171-127737193 GGGCCGGGCTGGTCGCACCCGGG + Intergenic
1076482873 10:130796360-130796382 GGCCCTGGGTGCTGGCACCTGGG - Intergenic
1076548514 10:131261981-131262003 GTGCCTGTGTGGTGCCTTCCAGG + Intronic
1076697863 10:132255802-132255824 GGGCCATGGTGCTGGCACCCAGG - Intronic
1077205026 11:1337766-1337788 GGGCCTGGGGGGCGCCTCCGGGG + Intergenic
1077230490 11:1456296-1456318 TGGCCTGGCAGGTCCCACCCTGG - Intronic
1077303427 11:1857330-1857352 GGCCCTGGCCGGTGACACCCTGG + Intronic
1077539591 11:3140285-3140307 GGGCCAGCATGGTGCCACCCAGG + Intronic
1078334297 11:10451331-10451353 GGACCTGGGACTTGCCACCCTGG + Intronic
1079592009 11:22192933-22192955 GGGCCAGCGTGGAGCCAGCCGGG + Intergenic
1080030644 11:27657041-27657063 GGGCCTGGGAGGTGCATCACGGG + Exonic
1081566083 11:44262124-44262146 GAGCCTGGGACGTGCCACCCAGG - Exonic
1081584479 11:44375043-44375065 GGGACAGGGCAGTGCCACCCAGG - Intergenic
1083272574 11:61579861-61579883 GGGACTGGGTGGAGCACCCCAGG + Intronic
1083305318 11:61759066-61759088 GTGCCTGCGTGGGGCCACGCCGG + Intronic
1083606078 11:63979622-63979644 GGGCCAGGGAGCTGCCAGCCAGG - Intronic
1083626567 11:64074906-64074928 GGGTCAGGGAGATGCCACCCTGG + Intronic
1083771163 11:64868409-64868431 GCGCTTGGGTTGTTCCACCCGGG - Intronic
1084264493 11:67997862-67997884 CGGCCTGCGTGGCTCCACCCTGG - Intronic
1084527082 11:69704222-69704244 CGGCCTGGGCGGGGTCACCCCGG - Exonic
1084586743 11:70066847-70066869 CGGCCTGGTTGCTGCCAGCCAGG + Intergenic
1084666552 11:70579520-70579542 AGGCCTGGGAGATGCCACCTGGG - Intronic
1085046605 11:73357151-73357173 GGGTTTGGGTGGTGCCAACAGGG + Intronic
1088849176 11:113691060-113691082 AGGCCTGGCTGGTGGAACCCAGG - Intronic
1089095685 11:115918254-115918276 TGGCCTGGGAGGTGCCAGCAGGG + Intergenic
1089273204 11:117315678-117315700 CGGCCTGGGGGGCGCCCCCCTGG - Exonic
1095208018 12:39460699-39460721 GGGCCTGGGCACTGCCATCCGGG - Intergenic
1096561301 12:52437763-52437785 GGGCCAGGGCGGGGCCACCAGGG + Intergenic
1096621958 12:52870719-52870741 GGGCCAGGCTGGTGCCGCCCTGG - Intergenic
1096627912 12:52906562-52906584 AGGCCTGGGTGGGGCCAGGCAGG + Intronic
1097107967 12:56636203-56636225 GGAGCTGGGTGGTCCCAGCCTGG - Exonic
1100266228 12:92978877-92978899 GGGGCAGGGTGGTGGCATCCAGG - Intergenic
1102059288 12:109920664-109920686 GGGCCTGGGTGGTGAGGCCTGGG - Intronic
1102959742 12:117084878-117084900 GGGCCTTGGGGGTGCCCCTCAGG - Intronic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1104425861 12:128677645-128677667 GGACCAGGGTGGGGGCACCCAGG - Intronic
1104459161 12:128940477-128940499 GGGCCAGGGTCAGGCCACCCAGG - Intronic
1104623754 12:130337440-130337462 GGGCCTGGGTGGGGCTGGCCGGG + Intergenic
1104710011 12:130979066-130979088 GGGTGTGGGTGGTGCCAGCCAGG + Intronic
1105337422 13:19486868-19486890 TGGCCTGGGTGGTGCCTGCCAGG + Intronic
1106070488 13:26406744-26406766 TGCCCTGGGTGCTGCCATCCAGG + Intergenic
1106479263 13:30124383-30124405 GTGCCTGGGTGGTGCCCCAGTGG - Intergenic
1106978752 13:35252840-35252862 GGGCCTGAATGTTGCCCCCCAGG + Intronic
1108396503 13:49996539-49996561 GGTCCCGGGTGGGGCCGCCCGGG - Intronic
1108632699 13:52302271-52302293 TGGCCTGGGTGGTGCCTGCCAGG + Intergenic
1108653999 13:52510326-52510348 TGGCCTGGGTGGTGCCTGCCAGG - Intergenic
1108729547 13:53220172-53220194 GGCACTGGGTGGTGGCAGCCTGG + Intergenic
1110450853 13:75636272-75636294 GGGCCGGGGCGGGGCCACCGCGG + Intronic
1112508831 13:99991128-99991150 CGGCCTGGGGAGTGCCGCCCTGG - Intergenic
1112672351 13:101654772-101654794 GGGCCTGGATGCAACCACCCAGG + Intronic
1113523058 13:110954099-110954121 GGGGCTGGGCGCTGCCACTCAGG + Intergenic
1113565227 13:111315753-111315775 GGGCTTTGCTGGGGCCACCCAGG - Intergenic
1113702311 13:112396710-112396732 GGGGCTGGGCGCTGCCACTCAGG - Intronic
1113737851 13:112690614-112690636 GGGCCTCGGAGTTGACACCCTGG + Intronic
1113797744 13:113068295-113068317 GCACCTGGGTGGTGCAACGCTGG + Intronic
1113797817 13:113068757-113068779 GCACCTGGGTGGTGCAACGCTGG + Intronic
1114259105 14:21024977-21024999 GGGCCTGGAAGGCGCCAGCCGGG - Intronic
1114615575 14:24066412-24066434 AGGCCTGGGTGCTGCCCTCCTGG - Exonic
1118438240 14:65790475-65790497 GGGCCTGGCTGATGCCTGCCTGG + Intergenic
1119477965 14:74942066-74942088 GGGGCAGGGTGGTGGCACCTTGG + Exonic
1120953492 14:90062175-90062197 GGGCCTGGGGGCTGCCCCCGGGG + Exonic
1121339011 14:93094006-93094028 GGGCCTGGCTGGAGCGCCCCAGG - Intronic
1121584299 14:95052319-95052341 GGGCCTGGGGGGTGGCAGGCAGG - Intergenic
1122115475 14:99525325-99525347 GGGCCTATGTGGGGCCACCCTGG + Intronic
1122127761 14:99588307-99588329 CGGCCTGGCTGAAGCCACCCTGG - Intronic
1122163671 14:99804932-99804954 GGCCCTGGATGCAGCCACCCTGG + Intronic
1122636413 14:103131815-103131837 GGGACTGGGAGGTGCCCCCAGGG + Intronic
1122833973 14:104422017-104422039 CGGCCTGGGTGGTGCCAGGAGGG - Intergenic
1125578592 15:40770719-40770741 GGGCTTGGGTGGGGCCAGCAGGG - Exonic
1128240425 15:66097470-66097492 GGGTTAGGGTGCTGCCACCCTGG + Intronic
1128250757 15:66162706-66162728 TGGTCTGGGTGGGGCCACACAGG + Intronic
1128773524 15:70301608-70301630 GGGCCAGGGTGGGGCTGCCCAGG - Intergenic
1128982044 15:72195432-72195454 GGGGCGGGGTGGAGCCACCCAGG + Intronic
1129205238 15:74033436-74033458 TGGCCTGGGTGCTGCCCGCCAGG + Intronic
1130295741 15:82646490-82646512 GGGCCTGGCGGGAGGCACCCCGG + Intronic
1132542234 16:515947-515969 GGCGCTCGGTGGTGCCACTCTGG - Intronic
1132609068 16:806063-806085 GGACCCGGGTGCTGCCACACGGG - Intronic
1132883781 16:2173574-2173596 GGGGCTGGGTTGTGAGACCCGGG + Intronic
1132885521 16:2180481-2180503 GGCCCTGGCTAGTGCCAACCTGG - Exonic
1132933886 16:2471565-2471587 GGGCCGGGCTGGGGCCGCCCGGG + Exonic
1133038382 16:3046857-3046879 GGGCCTGGCTGGGGCCGCCCCGG - Exonic
1133127403 16:3655801-3655823 GAGCAGGGCTGGTGCCACCCAGG - Intronic
1133287429 16:4697147-4697169 AGGGCTGGGTGGTGCTGCCCCGG + Intronic
1133930037 16:10224476-10224498 GGGACTTGGTGGGGACACCCAGG + Intergenic
1134501251 16:14770777-14770799 GGGCCTGGGAGCTGCCACAGAGG - Intronic
1134579329 16:15358257-15358279 GGGCCTGGGAGCTGCCACAGAGG + Intergenic
1134723253 16:16399297-16399319 GGGCCTGGGAGCTGCCACAGAGG - Intergenic
1134944175 16:18312573-18312595 GGGCCTGGGAGCTGCCACAGAGG + Intergenic
1135504552 16:23025076-23025098 GGGCCTTGCTCTTGCCACCCCGG - Intergenic
1136003598 16:27313943-27313965 GGGCCAGGGAAGGGCCACCCAGG + Exonic
1136628265 16:31474694-31474716 TGGCCTGGGTGGGAACACCCCGG - Exonic
1136655014 16:31704305-31704327 GGTCCAGTGTGCTGCCACCCAGG - Intergenic
1138552820 16:57756676-57756698 GGGCCTGGGTGGTTCCCCTCTGG + Intronic
1141464246 16:84195980-84196002 GGGGCTGGGTGGTGCCCTGCTGG + Exonic
1141644762 16:85361534-85361556 GTGCCAGGGTGGGGCCACCATGG - Intergenic
1141805370 16:86338120-86338142 GGGTCCAGGTGGTGGCACCCAGG - Intergenic
1142112902 16:88341618-88341640 GGGCCTGCCTGCTGCCACCCTGG - Intergenic
1142126618 16:88413784-88413806 GGGCCTGGGCAGTGCCACAGAGG + Intergenic
1142288864 16:89183565-89183587 GGACCTGGGAGGATCCACCCTGG + Exonic
1142699709 17:1651472-1651494 TGGCATGGGTGGTGACATCCTGG + Exonic
1143275276 17:5705612-5705634 GGGACTGGGTGATCCCAGCCAGG + Intergenic
1143956258 17:10671875-10671897 GGGCGCGGGTGTTCCCACCCTGG - Intergenic
1144273054 17:13637802-13637824 GGGTGTGGGTGGTGCCTCCCAGG + Intergenic
1146053897 17:29571894-29571916 TGGCCTGGGTAGAGCCAGCCTGG + Exonic
1146370981 17:32265712-32265734 GGGCCCGGGTGGCGGCGCCCGGG + Intergenic
1146797768 17:35795074-35795096 GTGCCTGTGTGGTTCCAGCCTGG + Intronic
1147076048 17:37988969-37988991 TGGCCTGGGTCGTGCCTCTCAGG + Intronic
1147077755 17:38004090-38004112 TGGCCTGGGTCGTGCCTCTCAGG - Intronic
1147087573 17:38068515-38068537 TGGCCTGGGTCGTGCCTCTCAGG + Exonic
1147248728 17:39139692-39139714 GGACCTGGGTGGGGGCACCCTGG - Exonic
1147649138 17:42051992-42052014 AGGGCTGTGTGGTGCCACTCGGG - Intronic
1148102100 17:45098516-45098538 GGGCTTTGGTAGTACCACCCCGG - Exonic
1148670171 17:49404350-49404372 GGGCCTGACTGTTGCCCCCCAGG - Exonic
1148770638 17:50064077-50064099 GCTCCTGGCTGGTGCCCCCCGGG + Exonic
1148777856 17:50105649-50105671 GGGCCTGGGTCTTGCCCACCGGG - Intronic
1149895036 17:60422547-60422569 GGACGTGGGGAGTGCCACCCTGG + Exonic
1150161371 17:62900996-62901018 GGTGCTGTGTGGTGCCTCCCAGG - Intergenic
1151604799 17:75129574-75129596 GGGCCTGGTGGATGCCAACCTGG + Exonic
1151881230 17:76896014-76896036 GGGCCTTGGTGTTGTCACCGTGG - Intronic
1151944778 17:77313562-77313584 GGGCCAGGCTGGGGCCAGCCTGG + Intronic
1152462996 17:80451019-80451041 GGGGCTGAGAGGAGCCACCCTGG + Intergenic
1154132151 18:11746709-11746731 TGGCTTGGTTGCTGCCACCCAGG + Intronic
1157080728 18:44522336-44522358 GCTCCTGGGTGGTGGCACCCTGG + Intergenic
1157388652 18:47282191-47282213 GGGGCTCAGTGGTGCCATCCAGG + Intergenic
1158392007 18:57051652-57051674 GGGCCAGGGTGGTGGCAGCAGGG + Intergenic
1161220370 19:3115617-3115639 GGGCCTGGTTGGAGCCAGCATGG + Intronic
1162033756 19:7928185-7928207 ACGCCTGCGTGATGCCACCCAGG + Intronic
1162871489 19:13590027-13590049 GGGCCGGTCTGGTGTCACCCAGG - Intronic
1162872599 19:13597861-13597883 GGGCCAGGGTGGTGCAAGCTTGG - Intronic
1163692456 19:18745122-18745144 GGGCCTGGGGAGGGCCAGCCTGG + Intronic
1164648075 19:29873536-29873558 AGGCCTGGGTGGCGCAGCCCGGG + Intergenic
1165105029 19:33464185-33464207 GGGCCTTGGTGGCCCCACTCTGG - Intronic
1166001405 19:39879686-39879708 GGCCCTGGGTGCTGACCCCCGGG + Exonic
1166004188 19:39895937-39895959 GGCCCTGGGTGCTGACCCCCGGG + Exonic
1166354716 19:42220214-42220236 GCGCCTGCGTGTTGCCACACAGG - Intergenic
1167593214 19:50415373-50415395 GGGCCAGGCTGGTGCCTCCACGG - Intronic
1167673565 19:50870676-50870698 TGGCCTGCGTGGTGCCAGGCCGG + Intronic
1167699686 19:51035184-51035206 GGGGCTGGGTCTTCCCACCCTGG - Intronic
1167926046 19:52821664-52821686 AGGCCTGGGTGGAGCCAACGAGG + Intronic
1167930230 19:52857650-52857672 AGGCCTGGGTGGAGCCAACGAGG + Intergenic
1168264792 19:55216864-55216886 GGTCCTGGGTGGGGCCAGCCAGG + Intergenic
1168264793 19:55216867-55216889 GGTCCTGGCTGGCCCCACCCAGG - Intergenic
1168687748 19:58358568-58358590 GGGCCTGGGGGCTGGCACCTGGG + Exonic
925140627 2:1547469-1547491 GGGCCTGGGTTGTGGCACTCAGG + Intergenic
925289749 2:2739483-2739505 GTGCCTGGGTGTTACCACCTAGG - Intergenic
925340522 2:3132492-3132514 AGGCCTGGGTAGGGCCGCCCGGG - Intergenic
925385631 2:3459813-3459835 GGGCATGGGTGGGGCCCTCCGGG + Intronic
925444909 2:3919319-3919341 GGGCCTGGGTGATGGCACGGTGG + Intergenic
925560788 2:5192386-5192408 GGACCTGGGCTGTGCCATCCTGG + Intergenic
926007603 2:9384721-9384743 GGTCCTGGAGGGTGGCACCCAGG - Intronic
926633985 2:15161631-15161653 GAGCCTGGGTTGTTTCACCCCGG + Intergenic
928063271 2:28136418-28136440 GGGCCTGGCTAGGGCCAGCCTGG - Intronic
928324881 2:30311398-30311420 GGGCCAGAGAGGGGCCACCCTGG - Intronic
928452455 2:31388703-31388725 GGGCGTGGCTGGTGTCTCCCAGG + Intronic
930013590 2:46956025-46956047 GGCCCTGGGCTGTGCCACCCTGG - Intronic
930701091 2:54457692-54457714 GGGCCTGGGTGGGGCCGGGCGGG - Intronic
932932457 2:76058364-76058386 GGGCCTGATTGTTGCCCCCCAGG + Intergenic
933725667 2:85425776-85425798 GGCCCTGGGTGGTGGCACTAAGG + Intronic
933897629 2:86825557-86825579 GTGCCTGGGTGCTGCCTGCCAGG - Intronic
934088362 2:88529288-88529310 GGACCTGGTTGGGGTCACCCTGG - Exonic
934520489 2:95017243-95017265 AGGCCTGGGAGGTGACAGCCTGG + Intergenic
934781053 2:96969947-96969969 GGGCGGGGGCGATGCCACCCTGG - Intronic
937032614 2:118753123-118753145 GGCGGTGGATGGTGCCACCCAGG + Intergenic
937103047 2:119286381-119286403 GGTCCTTGGTTGTGCCTCCCAGG + Intergenic
937237319 2:120438609-120438631 GGCCCAGGATGGGGCCACCCAGG + Intergenic
944515598 2:200509513-200509535 GGGCCTGCGGAGTGCCCCCCTGG - Intronic
944828654 2:203510506-203510528 TTGCCTGGGGGATGCCACCCTGG - Intronic
948494628 2:238339452-238339474 GTGCCTGGGTGTTTCCCCCCAGG - Intronic
948507620 2:238440504-238440526 GGGGCTGGCTGGTGCCACACAGG - Intronic
948633052 2:239314144-239314166 GGTGCTGGGAGGTGCCACCTGGG - Intronic
948663963 2:239523228-239523250 GGCCCTGGCGGGTTCCACCCTGG - Intergenic
948752308 2:240139752-240139774 GGGCCTGGGGGCTGGAACCCAGG + Intronic
948752968 2:240143111-240143133 TGGCCAGGGTGGTGCCCTCCAGG - Intronic
948765166 2:240215768-240215790 GAGCCTGGCTGGGGCCTCCCTGG + Intergenic
948883634 2:240872595-240872617 GGCCCAGCCTGGTGCCACCCTGG + Intronic
1171354449 20:24533556-24533578 GGTCCTCGGTGGTGCTTCCCGGG - Intronic
1172050721 20:32115496-32115518 GGGCATGGATGGGGACACCCAGG + Intronic
1172215705 20:33234175-33234197 GAGTCTGGGTGGTGCCCCCAAGG - Intergenic
1172447202 20:34999472-34999494 GTGCCCTGGTGGGGCCACCCTGG + Intronic
1172646402 20:36472897-36472919 GGGACTGGGTGGGGCCCCGCAGG + Intronic
1173138771 20:40463523-40463545 GAGCCTGGGAGCTGACACCCTGG + Intergenic
1174499771 20:50976055-50976077 GGGCCTGTGGGCTGCCCCCCGGG + Intergenic
1175249163 20:57598364-57598386 GGGGCTGGGAGGTGACAGCCAGG + Intergenic
1175821717 20:61913608-61913630 GGGCCTGGGCACCGCCACCCCGG + Intronic
1175916479 20:62428295-62428317 GCACCTGGGCCGTGCCACCCGGG - Intergenic
1175940472 20:62535432-62535454 GGGCCTGGGGGCTGCTACTCAGG - Intergenic
1176233797 20:64044996-64045018 GGGCCTGGGTGCTCCATCCCTGG - Intronic
1176736148 21:10548508-10548530 TGGCCTGGGTGGTGCCTGCCAGG - Intronic
1179959952 21:44762599-44762621 GGGCCTGGGAGCTGCGTCCCTGG - Intergenic
1179968304 21:44818968-44818990 GTGCCCGGGTGGTGCCAGCCGGG + Intergenic
1180080938 21:45487265-45487287 GGGCCTGGGTGGAGCCCCCCCGG - Intronic
1180086469 21:45509985-45510007 GGGCCGGGGTGGTGCGCCCGGGG + Intronic
1180101886 21:45591204-45591226 GGGCCTGGGAGGCGCGTCCCAGG - Intergenic
1182572708 22:31250653-31250675 GGGTCTGGGTGGTCCCTCCCTGG - Intronic
1183321416 22:37167240-37167262 GGGCAGGGGTGCTGTCACCCAGG - Intronic
1183533000 22:38374347-38374369 TGGCCTGGGTGGTGCCTGCCAGG + Intronic
1183620443 22:38968936-38968958 GGTCCTGGGAGGTATCACCCAGG + Intronic
1183713588 22:39520826-39520848 GGGCCAGGGCGGTGCCGCCAAGG + Exonic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1184647336 22:45903407-45903429 GGGGCTGGGTGGTGACATCATGG + Intergenic
1184741208 22:46430008-46430030 GGGCCTGGGAGCTGCCAGGCTGG - Intronic
1185050614 22:48552268-48552290 GTGCCTGGCTGCTGTCACCCAGG + Intronic
1185080610 22:48707585-48707607 GTCCCTGGGTGGAGCCACGCCGG + Intronic
1185231715 22:49687599-49687621 GGGCCTGGGAGGTGGCGCTCCGG - Intergenic
1185402738 22:50627147-50627169 GGGCCCGGGTGGTTCCTACCTGG + Exonic
953135146 3:40175616-40175638 GGGCCAGCCTGGTGCCCCCCAGG + Intronic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
954304427 3:49717923-49717945 GGGCCTGGGTGGGGGAGCCCTGG + Exonic
954454582 3:50590833-50590855 GGCCCTTGGTGGTGCCTCCAAGG + Intergenic
961505118 3:127365530-127365552 GGGTCAGGGTGGGGCCAGCCAGG - Intergenic
961644891 3:128387696-128387718 GGGTCTTGGTGGTGCCACAGGGG - Intronic
961661160 3:128469511-128469533 GGGGCTGGGTGCTGGGACCCTGG - Intergenic
961795878 3:129408569-129408591 GGGTGAGGGTGATGCCACCCAGG - Intronic
963168135 3:142225529-142225551 GGGCCCGGGTTGGGCCGCCCGGG - Exonic
1202746031 3_GL000221v1_random:102585-102607 GGGCCTGGGATGGGCCCCCCAGG + Intergenic
968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG + Intergenic
968809225 4:2792664-2792686 GGGCAGGGGTGGGGCCGCCCAGG + Intergenic
968902947 4:3439750-3439772 GGGCCTCAGGGGGGCCACCCTGG + Exonic
969053705 4:4388904-4388926 AGGCCACGGTGGTGCCACTCTGG + Intronic
969262849 4:6044458-6044480 GGTGCTGGGTGCTGCCACCGTGG - Intronic
969704358 4:8783952-8783974 GGCCCTGGATGGTGCAGCCCAGG - Intergenic
979349213 4:119627065-119627087 GGTGCTGGGTGGTGGCGCCCCGG - Intronic
979366059 4:119824884-119824906 GGGCTTGGGTGATGTCACCATGG - Intergenic
980396219 4:132219036-132219058 GGATCTGGGTGGTAACACCCTGG - Intergenic
982020313 4:151196376-151196398 GGGCTGTGGTGGTGCCATCCTGG - Intronic
985552686 5:541443-541465 GGGGCTGGTTGGGGCCACCTGGG + Intergenic
985694953 5:1335014-1335036 GCGCCTGGGTGAGGCCGCCCTGG - Intronic
985725154 5:1512220-1512242 TGTGCTGGGTGGTGCCACACAGG + Intronic
985821891 5:2166205-2166227 GGGCCTGAGGGGTGCCAGCATGG + Intergenic
986808608 5:11332357-11332379 AGGCCTGGGTGCTGCCTCCCTGG + Intronic
997206420 5:132052803-132052825 GGGTCTGGGTGGGCCCACTCAGG + Intergenic
997588491 5:135058713-135058735 GGGCCTGGGAGGTACCATCAGGG - Intronic
1000662006 5:163949140-163949162 GGCCCTGAGTGGCGCCACTCGGG + Intergenic
1000876021 5:166639151-166639173 GAGCCTGGGAGGTGACACCAAGG - Intergenic
1002639171 5:180622551-180622573 GGGCCTGGGTGCTGGCGCACTGG - Intronic
1003135278 6:3430448-3430470 GGGACTGGGTGGTGGCACAAAGG - Intronic
1006410169 6:33868897-33868919 GGTCATGGGTGGTGCCAGCTGGG - Intergenic
1006696235 6:35932846-35932868 AGGCAAGGGTGGTGCCACCAAGG - Intergenic
1007782922 6:44264529-44264551 AGGCATGGGGGGTGCCACCAGGG - Intronic
1008636918 6:53419816-53419838 GGGCCTGGGTGATCCCTCCAGGG - Intergenic
1019265130 7:110941-110963 GGGGCTGTGTGGGGCCAGCCTGG - Intergenic
1019281175 7:200995-201017 GAGCCTGGGTGTGGGCACCCGGG + Intronic
1019449269 7:1088369-1088391 GCGGGTGGGTGGTGCCACCCAGG + Intronic
1019727436 7:2610948-2610970 TAGCCTGTGTGGGGCCACCCGGG + Exonic
1019923831 7:4179706-4179728 GGGCCATGGTGGGGCCACCAAGG + Intronic
1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG + Intergenic
1021510490 7:21427965-21427987 GGGCCAGGGCGGTGCGAGCCTGG - Intergenic
1023377030 7:39566618-39566640 GGGCCAGGCTGGGGCCACTCTGG - Intronic
1023822644 7:43988509-43988531 TGGCATGGGAGGTCCCACCCTGG + Intergenic
1024063218 7:45714057-45714079 GGTCCTGGCTGGAGCCACCGTGG - Exonic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1029420173 7:100468036-100468058 GGGTCTGGCTGGTGCCAGGCAGG + Intronic
1029618736 7:101676729-101676751 GGCCCTGGGTTGTGCAAACCTGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1029750907 7:102541924-102541946 TGGCATGGGAGGTCCCACCCTGG + Intronic
1029768861 7:102641035-102641057 TGGCATGGGAGGTCCCACCCTGG + Intronic
1032115320 7:129111801-129111823 GTGCATGGGTGTTGCCTCCCTGG + Intergenic
1033277823 7:139985913-139985935 GGTCCTGGTTGGTAGCACCCAGG + Intronic
1034166379 7:149028239-149028261 GGGCCTGGGCCCTGCGACCCCGG - Intronic
1035317636 7:158006756-158006778 GGGTCTGACTGGGGCCACCCTGG + Intronic
1035522102 8:283270-283292 GGGTCTGGGTGGGGTCACACTGG + Intergenic
1035818082 8:2562195-2562217 GGGGCTGGGTCGTGCGTCCCTGG - Intergenic
1036691476 8:10947437-10947459 GGGCATGGTTGGGGTCACCCTGG + Intronic
1038420554 8:27431483-27431505 GGGGCTGGGTGGGGCTGCCCCGG - Intronic
1041642019 8:60213525-60213547 GGGCCTGGTGGCTGCCATCCTGG - Intronic
1045006155 8:97918587-97918609 GGGCCTGAGCGATGCCTCCCAGG + Intronic
1048462156 8:134629896-134629918 GAGCCTGGGTGGTTTCACCTTGG - Intronic
1048469909 8:134696586-134696608 GCGGGTGGGTGGTGCCAGCCAGG - Intronic
1048522662 8:135171153-135171175 GGGGCTGGGTGGAGGCTCCCGGG + Intergenic
1049241817 8:141541659-141541681 ATGCCTGGGTGGGGCCAGCCAGG + Intergenic
1049412109 8:142478038-142478060 GGCCGTGGGTGGTGGCCCCCAGG + Intronic
1049474170 8:142789186-142789208 GGGCCTGGTTGGTACCATCAGGG + Intergenic
1049603525 8:143518886-143518908 CTGCCGGGCTGGTGCCACCCCGG - Intronic
1049604976 8:143525178-143525200 GCTGCTGGGAGGTGCCACCCAGG - Intronic
1049605917 8:143529134-143529156 GGGCCTGGTTGGAGCAAGCCGGG + Intronic
1049674414 8:143883343-143883365 GGGCCTGGGACGTGTCCCCCTGG + Intergenic
1049801204 8:144518189-144518211 GAGCCTGGGAGGTGCCACCGCGG + Intronic
1057353952 9:94320442-94320464 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353967 9:94320487-94320509 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353982 9:94320532-94320554 GGGCCTGGGTGGTGGCAGGCAGG + Exonic
1057653783 9:96937103-96937125 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1057653798 9:96937148-96937170 GGGCCTGGGTGGTGGCAGGTGGG - Exonic
1060106477 9:120876440-120876462 GGGCTGGGGGGGCGCCACCCGGG - Intronic
1060546983 9:124467677-124467699 GGGTCTGGGTGGTGCCAGGGGGG + Intronic
1060937300 9:127522874-127522896 GGTGCTGGGTGGAGCCAACCTGG - Intronic
1061232937 9:129325427-129325449 GGGCCTAAGAGGGGCCACCCAGG + Intergenic
1061864404 9:133485019-133485041 GGGGCTGGGTGGAGCATCCCTGG + Intergenic
1061878040 9:133554655-133554677 GGGCCTGCGAGGGGCCCCCCAGG + Exonic
1061908483 9:133710875-133710897 CAGCCTGGCTGGTGGCACCCAGG - Intronic
1061921656 9:133785746-133785768 GGACCTGGGGGCTGCCGCCCTGG + Intronic
1062320098 9:135986562-135986584 GGCCCTGGGTGCTTCCTCCCAGG - Intergenic
1062464968 9:136676901-136676923 GGGCCTGGGCGGGGCCAGGCAGG - Intronic
1062467640 9:136688045-136688067 GGGGCTGGGTTGCCCCACCCTGG + Intergenic
1062565723 9:137163122-137163144 GGGCCTTGGTCCTGCCAGCCTGG - Intronic
1062637555 9:137499608-137499630 GGACCTGGCTGGAGCCACTCAGG + Intronic
1203714653 Un_KI270742v1:132543-132565 GGGCCTGGGATGGGCCCCCCAGG + Intergenic
1186442871 X:9601151-9601173 GGGCCTGGAGGGTGGTACCCAGG + Intronic
1188499156 X:30806727-30806749 GTGCCTGGGTGGTGTCATCATGG + Intergenic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1195131830 X:101861014-101861036 GGGCCTGGGTGCTCCTACCTTGG - Intergenic
1197252328 X:124228996-124229018 GGACCCTGGTGGTTCCACCCAGG - Intronic
1198302725 X:135347127-135347149 GGCCCTGGGTTGTGCAATCCAGG + Exonic
1202594439 Y:26521674-26521696 TGGCCTGGGTGGTGCCTGCCAGG - Intergenic