ID: 1192157936

View in Genome Browser
Species Human (GRCh38)
Location X:68760283-68760305
Sequence CCTCATCTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192157929_1192157936 0 Left 1192157929 X:68760260-68760282 CCTAACCTCTCATGCCTCAATTT No data
Right 1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
1192157930_1192157936 -5 Left 1192157930 X:68760265-68760287 CCTCTCATGCCTCAATTTCCTCA No data
Right 1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192157936 Original CRISPR CCTCATCTGTAAAATGGGGA TGG Intergenic
Too many off-targets to display for this crispr