ID: 1192160414

View in Genome Browser
Species Human (GRCh38)
Location X:68782218-68782240
Sequence GAATCTGCACTGATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192160414_1192160416 7 Left 1192160414 X:68782218-68782240 CCTGGCTGCATCAGTGCAGATTC No data
Right 1192160416 X:68782248-68782270 ATGCAAATCGTCTCCACAAAAGG No data
1192160414_1192160419 20 Left 1192160414 X:68782218-68782240 CCTGGCTGCATCAGTGCAGATTC No data
Right 1192160419 X:68782261-68782283 CCACAAAAGGCAGCTCTGCAGGG No data
1192160414_1192160417 19 Left 1192160414 X:68782218-68782240 CCTGGCTGCATCAGTGCAGATTC No data
Right 1192160417 X:68782260-68782282 TCCACAAAAGGCAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192160414 Original CRISPR GAATCTGCACTGATGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr